Clone AT15135 Report

Search the DGRC for AT15135

Clone and Library Details

Library:AT
Tissue Source:Drosophila melanogaster adult testes
Created by:Ling Hong
Date Registered:2000-06-08
Comments:Oligo dT-primed and directionally cloned at EcoRI and XhoI in pOTB7
Original Plate Number:151
Well:35
Vector:pOTB7
Associated Gene/TranscriptCG31639-RA
Protein status:AT15135.pep: gold
Sequenced Size:495

Associated Genes

Associations are from manual ordering of a clone or by a periodic analysis.
Gene Date Evidence
Lost to the ancients 2009-01-15 I'm sure there was a reason

Clone Sequence Records

AT15135.complete Sequence

495 bp assembled on 2009-01-15

GenBank Submission: BT057972.1

> AT15135.complete
GAATTTTTATCTGGAGCTCTCTAGTCAGGCCAAAACAGCACTGAAAATCT
CTGAATAAAAACTCACTATCCAAATTCCAAGTTAACACCTTAAGTTTTTC
CGTTTCTGAATCCGTGAAGCCTAGCAACAATATGTGCGGTTATGGATGCG
GTCCCTATGGCTATGGACCTTCGGGTCCTTGCGGACCATGGTGCGGACCC
TGGTGTAGTCCTTGTGCCCTCTCGCTAGGACCCTATTCCTGCTGTGGACC
CAGTGGATGCGGACCAAGCGGCCCAGCGTGTTGGCCGTATGGCTTGTACA
CCTGCTAGGCTTCAGAAGGATATCAGAAACGTGTGAGCCATTCCCCAAGA
AATGTAATACAAGCTCGGACAATGGCAATTACATTGGATAGCATAATAAA
AATATGTTCCCGTTGTTTTCATTAAAGACCATAATAAAATGTGGGGAAAG
GCAGATGGAAATCGCAGCCCCTAACAAAAAAAAAAAAAAAAAAAA

AT15135.complete Blast Records

Blast to MB8.fasta performed 2010-07-15 21:19:13
Subject Length Description Subject Range Query Range Score Percent Strand
CG31639-RA 635 CG31639-RA 68..545 1..478 2345 99.3 Plus
CG31639.a 824 CG31639.a 257..734 1..478 2345 99.3 Plus
CG31639-RB 643 CG31639-RB 198..553 123..478 1750 99.4 Plus
CG31639-RB 643 CG31639-RB 63..187 1..125 610 99.2 Plus
Blast to d_melanogaster_OreR.fa performed 2019-03-16 01:41:26
Subject Length Description Subject Range Query Range Score Percent Strand
chr2L 23010047 chr2L 6153698..6153935 360..123 1175 99.6 Minus
chr2L 23010047 chr2L 6154000..6154123 124..1 605 99.2 Minus
chr2L 23010047 chr2L 6152967..6153080 475..362 570 100 Minus
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 15:49:44 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-16 01:41:24
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 6154647..6154884 360..123 1175 99.6 Minus
2L 23513712 2L 6154949..6155072 124..1 605 99.2 Minus
2L 23513712 2L 6153913..6154029 478..362 585 100 Minus
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 22:36:30
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 6154647..6154884 360..123 1175 99.5 Minus
2L 23513712 2L 6154949..6155072 124..1 605 99.1 Minus
2L 23513712 2L 6153913..6154029 478..362 585 100 Minus
Blast to na_te.dros performed on 2019-03-16 01:41:24 has no hits.

AT15135.complete Sim4 Records

Sim4 to d_melanogaster_OreR.fa performed 2019-03-16 01:42:15 Download gff for AT15135.complete
Subject Subject Range Query Range Percent Splice Strand
chr2L 6152967..6153078 364..475 100 <- Minus
chr2L 6153695..6153933 125..363 99 <- Minus
chr2L 6154000..6154123 1..124 99   Minus
Sim4 to dmel-all-CDS-r5.12.fasta performed 2009-10-19 17:59:09 Download gff for AT15135.complete
Subject Subject Range Query Range Percent Splice Strand
CG31639-RB 1..177 132..308 100   Plus
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 21:28:15 Download gff for AT15135.complete
Subject Subject Range Query Range Percent Splice Strand
CG31639-RB 1..177 132..308 100   Plus
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 06:41:30 Download gff for AT15135.complete
Subject Subject Range Query Range Percent Splice Strand
CG31639-RA 1..177 132..308 100   Plus
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-27 04:40:02 Download gff for AT15135.complete
Subject Subject Range Query Range Percent Splice Strand
CG31639-RA 1..177 132..308 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2009-01-15 12:44:17 Download gff for AT15135.complete
Subject Subject Range Query Range Percent Splice Strand
CG31639-RA 17..491 1..475 99   Plus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 21:28:14 Download gff for AT15135.complete
Subject Subject Range Query Range Percent Splice Strand
CG31639-RA 17..491 1..475 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 06:41:30 Download gff for AT15135.complete
Subject Subject Range Query Range Percent Splice Strand
CG31639-RA 17..491 1..475 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 04:40:02 Download gff for AT15135.complete
Subject Subject Range Query Range Percent Splice Strand
CG31639-RA 1..475 1..475 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 01:42:15 Download gff for AT15135.complete
Subject Subject Range Query Range Percent Splice Strand
2L 6154949..6155072 1..124 99   Minus
2L 6153916..6154027 364..475 100 <- Minus
2L 6154644..6154882 125..363 99 <- Minus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 01:42:15 Download gff for AT15135.complete
Subject Subject Range Query Range Percent Splice Strand
2L 6154949..6155072 1..124 99   Minus
2L 6153916..6154027 364..475 100 <- Minus
2L 6154644..6154882 125..363 99 <- Minus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 01:42:15 Download gff for AT15135.complete
Subject Subject Range Query Range Percent Splice Strand
2L 6154949..6155072 1..124 99   Minus
2L 6153916..6154027 364..475 100 <- Minus
2L 6154644..6154882 125..363 99 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 06:41:30 Download gff for AT15135.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2L 6153916..6154027 364..475 100 <- Minus
arm_2L 6154644..6154882 125..363 99 <- Minus
arm_2L 6154949..6155072 1..124 99   Minus
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 19:00:59 Download gff for AT15135.complete
Subject Subject Range Query Range Percent Splice Strand
2L 6154644..6154882 125..363 99 <- Minus
2L 6154949..6155072 1..124 99   Minus
2L 6153916..6154027 364..475 100 <- Minus

AT15135.pep Sequence

Translation from 131 to 307

> AT15135.pep
MCGYGCGPYGYGPSGPCGPWCGPWCSPCALSLGPYSCCGPSGCGPSGPAC
WPYGLYTC*

AT15135.pep Blast Records

Blast to dere-all-translation-r1.3.fasta performed 2019-03-15 11:10:05
Subject Length Description Subject Range Query Range Score Percent Strand
Dere\GG23637-PA 59 GG23637-PA 14..59 14..58 182 93.5 Plus
Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 10:47:31
Subject Length Description Subject Range Query Range Score Percent Strand
CG31639-PB 58 CG31639-PB 1..58 1..58 389 100 Plus
CG31639-PA 58 CG31639-PA 1..58 1..58 389 100 Plus
Mst84Dd-PA 72 CG17935-PA 2..51 5..54 148 58.2 Plus
Mst98Cb-PA 265 CG18396-PA 207..257 2..58 146 57.6 Plus
Mst98Ca-PA 334 CG11719-PA 217..281 2..58 146 48.5 Plus
Mst84Dc-PB 55 CG17945-PB 6..47 2..54 139 54.7 Plus
Mst84Dc-PA 55 CG17945-PA 6..47 2..54 139 54.7 Plus
Mst98Ca-PA 334 CG11719-PA 198..240 8..54 139 55.3 Plus
Mst84Db-PA 74 CG17934-PA 3..67 6..52 138 43.9 Plus
Blast to dsim-all-translation-r1.4.fasta performed 2019-03-15 11:10:08
Subject Length Description Subject Range Query Range Score Percent Strand
Dsim\GD22594-PA 58 GD22594-PA 1..58 1..58 253 98.3 Plus
Blast to dyak-all-translation-r1.3.fasta performed 2019-03-15 11:10:09
Subject Length Description Subject Range Query Range Score Percent Strand
Dyak\GE18456-PA 61 GE18456-PA 14..61 14..58 169 89.6 Plus

AT15135.hyp Sequence

Translation from 131 to 307

> AT15135.hyp
MCGYGCGPYGYGPSGPCGPWCGPWCSPCALSLGPYSCCGPSGCGPSGPAC
WPYGLYTC*

AT15135.hyp Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-27 05:57:20
Subject Length Description Subject Range Query Range Score Percent Strand
CG31639-PB 58 CG31639-PB 1..58 1..58 389 100 Plus
CG31639-PA 58 CG31639-PA 1..58 1..58 389 100 Plus
Mst84Dd-PA 72 CG17935-PA 2..51 5..54 148 58.2 Plus
Mst98Cb-PA 265 CG18396-PA 207..257 2..58 146 57.6 Plus
Mst84Dc-PB 55 CG17945-PB 6..47 2..54 139 54.7 Plus