AT15135.complete Sequence
495 bp assembled on 2009-01-15
GenBank Submission: BT057972.1
> AT15135.complete
GAATTTTTATCTGGAGCTCTCTAGTCAGGCCAAAACAGCACTGAAAATCT
CTGAATAAAAACTCACTATCCAAATTCCAAGTTAACACCTTAAGTTTTTC
CGTTTCTGAATCCGTGAAGCCTAGCAACAATATGTGCGGTTATGGATGCG
GTCCCTATGGCTATGGACCTTCGGGTCCTTGCGGACCATGGTGCGGACCC
TGGTGTAGTCCTTGTGCCCTCTCGCTAGGACCCTATTCCTGCTGTGGACC
CAGTGGATGCGGACCAAGCGGCCCAGCGTGTTGGCCGTATGGCTTGTACA
CCTGCTAGGCTTCAGAAGGATATCAGAAACGTGTGAGCCATTCCCCAAGA
AATGTAATACAAGCTCGGACAATGGCAATTACATTGGATAGCATAATAAA
AATATGTTCCCGTTGTTTTCATTAAAGACCATAATAAAATGTGGGGAAAG
GCAGATGGAAATCGCAGCCCCTAACAAAAAAAAAAAAAAAAAAAA
AT15135.complete Blast Records
Blast to MB8.fasta performed 2010-07-15 21:19:13
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG31639-RA | 635 | CG31639-RA | 68..545 | 1..478 | 2345 | 99.3 | Plus |
CG31639.a | 824 | CG31639.a | 257..734 | 1..478 | 2345 | 99.3 | Plus |
CG31639-RB | 643 | CG31639-RB | 198..553 | 123..478 | 1750 | 99.4 | Plus |
CG31639-RB | 643 | CG31639-RB | 63..187 | 1..125 | 610 | 99.2 | Plus |
Blast to d_melanogaster_OreR.fa performed 2019-03-16 01:41:26
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
chr2L | 23010047 | chr2L | 6153698..6153935 | 360..123 | 1175 | 99.6 | Minus |
chr2L | 23010047 | chr2L | 6154000..6154123 | 124..1 | 605 | 99.2 | Minus |
chr2L | 23010047 | chr2L | 6152967..6153080 | 475..362 | 570 | 100 | Minus |
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 15:49:44 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-16 01:41:24
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
2L | 23513712 | 2L | 6154647..6154884 | 360..123 | 1175 | 99.6 | Minus |
2L | 23513712 | 2L | 6154949..6155072 | 124..1 | 605 | 99.2 | Minus |
2L | 23513712 | 2L | 6153913..6154029 | 478..362 | 585 | 100 | Minus |
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 22:36:30
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
2L | 23513712 | 2L | 6154647..6154884 | 360..123 | 1175 | 99.5 | Minus |
2L | 23513712 | 2L | 6154949..6155072 | 124..1 | 605 | 99.1 | Minus |
2L | 23513712 | 2L | 6153913..6154029 | 478..362 | 585 | 100 | Minus |
Blast to na_te.dros performed on 2019-03-16 01:41:24 has no hits.
AT15135.complete Sim4 Records
Sim4 to d_melanogaster_OreR.fa performed 2019-03-16 01:42:15 Download gff for
AT15135.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
chr2L | 6152967..6153078 | 364..475 | 100 | <- | Minus |
chr2L | 6153695..6153933 | 125..363 | 99 | <- | Minus |
chr2L | 6154000..6154123 | 1..124 | 99 | | Minus |
Sim4 to dmel-all-CDS-r5.12.fasta performed 2009-10-19 17:59:09 Download gff for
AT15135.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG31639-RB | 1..177 | 132..308 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 21:28:15 Download gff for
AT15135.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG31639-RB | 1..177 | 132..308 | 100 | | Plus |
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 06:41:30 Download gff for
AT15135.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG31639-RA | 1..177 | 132..308 | 100 | | Plus |
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-27 04:40:02 Download gff for
AT15135.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG31639-RA | 1..177 | 132..308 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.12.fasta performed 2009-01-15 12:44:17 Download gff for
AT15135.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG31639-RA | 17..491 | 1..475 | 99 | | Plus |
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 21:28:14 Download gff for
AT15135.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG31639-RA | 17..491 | 1..475 | 99 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 06:41:30 Download gff for
AT15135.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG31639-RA | 17..491 | 1..475 | 99 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 04:40:02 Download gff for
AT15135.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG31639-RA | 1..475 | 1..475 | 99 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 01:42:15 Download gff for
AT15135.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2L | 6154949..6155072 | 1..124 | 99 | | Minus |
2L | 6153916..6154027 | 364..475 | 100 | <- | Minus |
2L | 6154644..6154882 | 125..363 | 99 | <- | Minus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 01:42:15 Download gff for
AT15135.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2L | 6154949..6155072 | 1..124 | 99 | | Minus |
2L | 6153916..6154027 | 364..475 | 100 | <- | Minus |
2L | 6154644..6154882 | 125..363 | 99 | <- | Minus |
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 01:42:15 Download gff for
AT15135.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2L | 6154949..6155072 | 1..124 | 99 | | Minus |
2L | 6153916..6154027 | 364..475 | 100 | <- | Minus |
2L | 6154644..6154882 | 125..363 | 99 | <- | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 06:41:30 Download gff for
AT15135.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_2L | 6153916..6154027 | 364..475 | 100 | <- | Minus |
arm_2L | 6154644..6154882 | 125..363 | 99 | <- | Minus |
arm_2L | 6154949..6155072 | 1..124 | 99 | | Minus |
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 19:00:59 Download gff for
AT15135.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2L | 6154644..6154882 | 125..363 | 99 | <- | Minus |
2L | 6154949..6155072 | 1..124 | 99 | | Minus |
2L | 6153916..6154027 | 364..475 | 100 | <- | Minus |
AT15135.pep Sequence
Translation from 131 to 307
> AT15135.pep
MCGYGCGPYGYGPSGPCGPWCGPWCSPCALSLGPYSCCGPSGCGPSGPAC
WPYGLYTC*
AT15135.pep Blast Records
Blast to dere-all-translation-r1.3.fasta performed 2019-03-15 11:10:05
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dere\GG23637-PA | 59 | GG23637-PA | 14..59 | 14..58 | 182 | 93.5 | Plus |
Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 10:47:31
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG31639-PB | 58 | CG31639-PB | 1..58 | 1..58 | 389 | 100 | Plus |
CG31639-PA | 58 | CG31639-PA | 1..58 | 1..58 | 389 | 100 | Plus |
Mst84Dd-PA | 72 | CG17935-PA | 2..51 | 5..54 | 148 | 58.2 | Plus |
Mst98Cb-PA | 265 | CG18396-PA | 207..257 | 2..58 | 146 | 57.6 | Plus |
Mst98Ca-PA | 334 | CG11719-PA | 217..281 | 2..58 | 146 | 48.5 | Plus |
Mst84Dc-PB | 55 | CG17945-PB | 6..47 | 2..54 | 139 | 54.7 | Plus |
Mst84Dc-PA | 55 | CG17945-PA | 6..47 | 2..54 | 139 | 54.7 | Plus |
Mst98Ca-PA | 334 | CG11719-PA | 198..240 | 8..54 | 139 | 55.3 | Plus |
Mst84Db-PA | 74 | CG17934-PA | 3..67 | 6..52 | 138 | 43.9 | Plus |
Blast to dsim-all-translation-r1.4.fasta performed 2019-03-15 11:10:08
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dsim\GD22594-PA | 58 | GD22594-PA | 1..58 | 1..58 | 253 | 98.3 | Plus |
Blast to dyak-all-translation-r1.3.fasta performed 2019-03-15 11:10:09
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Dyak\GE18456-PA | 61 | GE18456-PA | 14..61 | 14..58 | 169 | 89.6 | Plus |
AT15135.hyp Sequence
Translation from 131 to 307
> AT15135.hyp
MCGYGCGPYGYGPSGPCGPWCGPWCSPCALSLGPYSCCGPSGCGPSGPAC
WPYGLYTC*
AT15135.hyp Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-27 05:57:20
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG31639-PB | 58 | CG31639-PB | 1..58 | 1..58 | 389 | 100 | Plus |
CG31639-PA | 58 | CG31639-PA | 1..58 | 1..58 | 389 | 100 | Plus |
Mst84Dd-PA | 72 | CG17935-PA | 2..51 | 5..54 | 148 | 58.2 | Plus |
Mst98Cb-PA | 265 | CG18396-PA | 207..257 | 2..58 | 146 | 57.6 | Plus |
Mst84Dc-PB | 55 | CG17945-PB | 6..47 | 2..54 | 139 | 54.7 | Plus |