Clone BO11483 Report

Search the DGRC for BO11483

Clone and Library Details

Library:BO
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with open reading frames
Original Plate Number:114
Well:83
Vector:pDNR-Dual
Associated Gene/TranscriptCG17376-RB
Protein status:BO11483.pep: Imported from assembly
Sequenced Size:236

Clone Sequence Records

BO11483.3prime Sequence

234 bp (233 high quality bases) assembled on 2006-04-19

> BO11483.3prime
ATGGTCTAGAAAGCTTGCGGAAGCCACATGGATAAGTTGGGGGCGTGTTG
TAGTAGTTCCAGACACGGGGATCGGGAATGCCGCCCTCGGGCAGAGGGGG
ACAGCACATGCCCGGAGCAGGAGAGCACGGGATGGGAGACGGGGCTCCGC
ATGGCGGACTGTGGGGGCCACAGCAGGGTGTTTCATTACAGGGTCCACAG
CATCCACATCCGTTGCACATGTCGACTGATAACT

BO11483.3prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-06 14:24:08
Subject Length Description Subject Range Query Range Score Percent Strand
CG17376-PB 204 CG17376-RB 1..201 220..20 1005 100 Minus
CG17377-PC 864 CG17377-RC 388..512 175..51 275 88.8 Minus
CG17376-PA 138 CG17376-RA 1..31 220..190 155 100 Minus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-10 22:40:52
Subject Length Description Subject Range Query Range Score Percent Strand
CG17376-RB 518 CG17376-RB 158..360 222..20 1015 100 Minus
CG17376-RC 784 CG17376-RC 98..294 222..26 985 100 Minus
CG17377-RD 907 CG17377-RD 487..641 175..21 430 85.2 Minus
Blast to na_all.dmel.RELEASE6 performed 2015-02-10 22:40:47
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 6800487..6800683 26..222 985 100 Plus
2L 23513712 2L 6802059..6802187 47..175 420 88.4 Plus
Blast to na_te.dros performed on 2015-02-10 22:40:49 has no hits.

BO11483.3prime Sim4 Records

Sim4 to dmel-all-CDS-r4.3.fasta performed 2007-01-18 05:07:55 Download gff for BO11483.3prime
Subject Subject Range Query Range Percent Splice Strand
CG17376-PB 1..204 15..220 98   Minus
Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-10 04:32:10 Download gff for BO11483.3prime
Subject Subject Range Query Range Percent Splice Strand
CG17376-PB 1..204 15..220 98   Minus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-21 09:49:27 Download gff for BO11483.3prime
Subject Subject Range Query Range Percent Splice Strand
CG17376-RB 95..305 13..225 98   Minus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-10 23:59:38 Download gff for BO11483.3prime
Subject Subject Range Query Range Percent Splice Strand
CG17376-RB 155..365 13..225 98   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-10 23:59:38 Download gff for BO11483.3prime
Subject Subject Range Query Range Percent Splice Strand
2L 6800479..6800686 17..225 97   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-21 09:49:27 Download gff for BO11483.3prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 6800479..6800686 17..225 97   Plus

BO11483.5prime Sequence

234 bp (233 high quality bases) assembled on 2006-04-19

> BO11483.5prime
GAAGTTATCAGTCGACATGTGCAACGGATGTGGATGCTGTGGACCCTGTA
ATGAAACACCCTGCTGTGGCCCCCACAGTCCGCCATGCGGAGCCCCGTCT
CCCATCCCGTGCTCTCCTGCTCCGGGCATGTGCTGTCCCCCTCTGCCCGA
GGGCGGCATTCCCGATCCCCGTGTCTGGAACTACTACAACACGCCCCCAA
CTTATCCATGTGGCTTCCGCAAGCTTTCTAGACC

BO11483.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-06 14:24:08
Subject Length Description Subject Range Query Range Score Percent Strand
CG17376-PB 204 CG17376-RB 1..201 17..217 1005 100 Plus
CG17377-PC 864 CG17377-RC 388..512 62..186 275 88.8 Plus
CG17376-PA 138 CG17376-RA 1..31 17..47 155 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-13 01:39:24
Subject Length Description Subject Range Query Range Score Percent Strand
CG17376-RB 518 CG17376-RB 158..360 15..217 1015 100 Plus
CG17376-RC 784 CG17376-RC 98..294 15..211 985 100 Plus
CG17377-RD 907 CG17377-RD 487..641 62..216 430 85.2 Plus
Blast to na_all.dmel.RELEASE6 performed 2015-02-13 01:39:18
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 6800487..6800683 211..15 985 100 Minus
2L 23513712 2L 6802059..6802187 190..62 420 88.4 Minus
Blast to na_te.dros performed on 2015-02-13 01:39:21 has no hits.

BO11483.5prime Sim4 Records

Sim4 to dmel-all-CDS-r4.3.fasta performed 2007-01-18 05:07:56 Download gff for BO11483.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17376-PB 1..204 17..222 98   Plus
Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-10 04:32:11 Download gff for BO11483.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17376-PB 1..204 17..222 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-09-01 11:12:07 Download gff for BO11483.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17376-RB 95..305 12..224 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-13 03:19:24 Download gff for BO11483.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17376-RB 155..365 12..224 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-13 03:19:24 Download gff for BO11483.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 6800479..6800686 12..220 97   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-09-01 11:12:07 Download gff for BO11483.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 6800479..6800686 12..220 97   Minus

BO11483.complete Sequence

236 bp assembled on 2011-06-28

> BO11483.complete
GAAGTTATCAGTCGACATGTGCAACGGATGTGGATGCTGTGGACCCTGTA
ATGAAACACCCTGCTGTGGCCCCCACAGTCCGCCATGCGGAGCCCCGTCT
CCCATCCCGTGCTCTCCTGCTCCGGGCATGTGCTGTCCCCCTCTGCCCGA
GGGCGGCATTCCCGATCCCCGTGTCTGGAACTACTACAACACGCCCCCAA
CTTATCCATGTGGCTTCCGCAAGCTTTCTAGACCAT

BO11483.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-26 16:19:30
Subject Length Description Subject Range Query Range Score Percent Strand
CG17376-RB 204 CG17376-PB 1..201 17..217 1005 100 Plus
CG17376-RC 276 CG17376-PC 1..195 17..211 975 100 Plus
CG17377-RD 546 CG17377-PD 388..542 62..216 430 85.2 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:19:32
Subject Length Description Subject Range Query Range Score Percent Strand
CG17376-RB 518 CG17376-RB 158..360 15..217 1015 100 Plus
CG17376-RC 784 CG17376-RC 98..294 15..211 985 100 Plus
CG17377-RD 907 CG17377-RD 487..641 62..216 430 85.2 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:19:29
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 6800487..6800683 211..15 985 100 Minus
2L 23513712 2L 6802059..6802187 190..62 420 88.4 Minus
Blast to na_te.dros performed on 2014-11-26 16:19:29 has no hits.

BO11483.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-06-28 12:16:33 Download gff for BO11483.complete
Subject Subject Range Query Range Percent Splice Strand
CG17376-RB 100..300 17..220 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:57:59 Download gff for BO11483.complete
Subject Subject Range Query Range Percent Splice Strand
CG17376-RB 100..300 17..220 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:16:25 Download gff for BO11483.complete
Subject Subject Range Query Range Percent Splice Strand
CG17376-RB 160..360 17..220 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:16:25 Download gff for BO11483.complete
Subject Subject Range Query Range Percent Splice Strand
2L 6800479..6800681 17..220 98   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:57:59 Download gff for BO11483.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2L 6800479..6800681 17..220 98   Minus

BO11483.pep Sequence

Translation from 16 to 235

> BO11483.pep
MCNGCGCCGPCNETPCCGPHSPPCGAPSPIPCSPAPGMCCPPLPEGGIPD
PRVWNYYNTPPTYPCGFRKLSRP

BO11483.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 06:51:40
Subject Length Description Subject Range Query Range Score Percent Strand
CG17376-PB 67 CG17376-PB 1..67 1..67 440 100 Plus
CG17376-PC 91 CG17376-PC 1..65 1..65 428 100 Plus
CG17377-PD 181 CG17377-PD 109..180 2..66 336 76.4 Plus
CG17377-PE 207 CG17377-PE 109..179 2..65 330 76.1 Plus