Clone Sequence Records
BO11583.complete Sequence
235 bp assembled on 2010-02-09
GenBank Submission: FJ632113
> BO11583.complete
GAAGTTATCAGTCGACATGTGCAACGGATGTGGATGCTGTGGACCCTGTA
ATGAAACACCCTGCTGTGGCCCCCACAGTCCGCCATGCGGAGCCCCGTCT
CCCATCCCGTGCTCTCCTGCTCCGGGCATGTGCTGTCCCCCTCTGCCCGA
GGGCGGCATTCCCGATCCCCGTGTCTGGAACTACTACAACACGCCCCCAA
CTTATCCATGTGGCTTCGCAAGCTTTCTAGACCAT
BO11583.complete Blast Records
Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 04:23:50
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| CG17376-RB | 204 | CG17376-PB | 1..201 | 17..217 | 1005 | 100 | Plus |
| CG17376-RC | 276 | CG17376-PC | 1..195 | 17..211 | 975 | 100 | Plus |
| CG17377-RD | 546 | CG17377-PD | 388..542 | 62..216 | 430 | 85.2 | Plus |
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 04:23:51
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| CG17376-RB | 518 | CG17376-RB | 158..360 | 15..217 | 1015 | 100 | Plus |
| CG17376-RC | 784 | CG17376-RC | 98..294 | 15..211 | 985 | 100 | Plus |
| CG17377-RD | 907 | CG17377-RD | 487..641 | 62..216 | 430 | 85.2 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 04:23:49
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| 2L | 23513712 | 2L | 6800487..6800683 | 211..15 | 985 | 100 | Minus |
| 2L | 23513712 | 2L | 6802059..6802187 | 190..62 | 420 | 88.4 | Minus |
Blast to na_te.dros performed on 2014-11-28 04:23:50 has no hits.
BO11583.complete Sim4 Records
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 13:58:40 Download gff for
BO11583.complete
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| CG17376-RB | 1..204 | 17..221 | 99 | | Plus |
Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-02-09 18:09:59 Download gff for
BO11583.complete
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| CG17376-RB | 100..300 | 17..219 | 99 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 21:58:33 Download gff for
BO11583.complete
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| CG17376-RB | 100..300 | 17..219 | 99 | | Plus |
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-09-04 16:39:30 Download gff for
BO11583.complete
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| CG17376-RB | 100..300 | 17..219 | 99 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 05:27:41 Download gff for
BO11583.complete
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| CG17376-RB | 160..360 | 17..219 | 99 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 05:27:41 Download gff for
BO11583.complete
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| 2L | 6800479..6800681 | 17..219 | 98 | | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 21:58:33 Download gff for
BO11583.complete
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| arm_2L | 6800479..6800681 | 17..219 | 98 | | Minus |
BO11583.5prime Sequence
233 bp (232 high quality bases) assembled on 2006-04-19
> BO11583.5prime
GAAGTTATCAGTCGACATGTGCAACGGATGTGGATGCTGTGGACCCTGTA
ATGAAACACCCTGCTGTGGCCCCCACAGTCCGCCATGCGGAGCCCCGTCT
CCCATCCCGTGCTCTCCTGCTCCGGGCATGTGCTGTCCCCCTCTGCCCGA
GGGCGGCATTCCCGATCCCCGTGTCTGGAACTACTACAACACGCCCCCAA
CTTATCCATGTGGCTTCGCAAGCTTTCTAGACC
BO11583.5prime Blast Records
Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-06 14:26:04
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| CG17376-PB | 204 | CG17376-RB | 1..201 | 17..217 | 1005 | 100 | Plus |
| CG17377-PC | 864 | CG17377-RC | 388..512 | 62..186 | 275 | 88.8 | Plus |
| CG17376-PA | 138 | CG17376-RA | 1..31 | 17..47 | 155 | 100 | Plus |
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-11 10:14:49
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| CG17376-RB | 518 | CG17376-RB | 158..360 | 15..217 | 1015 | 100 | Plus |
| CG17376-RC | 784 | CG17376-RC | 98..294 | 15..211 | 985 | 100 | Plus |
| CG17377-RD | 907 | CG17377-RD | 487..641 | 62..216 | 430 | 85.2 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2015-02-11 10:14:45
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| 2L | 23513712 | 2L | 6800487..6800683 | 211..15 | 985 | 100 | Minus |
| 2L | 23513712 | 2L | 6802059..6802187 | 190..62 | 420 | 88.4 | Minus |
Blast to na_te.dros performed on 2015-02-11 10:14:47 has no hits.
BO11583.5prime Sim4 Records
Sim4 to dmel-all-CDS-r4.3.fasta performed 2007-01-18 05:10:39 Download gff for
BO11583.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| CG17376-PB | 1..204 | 17..221 | 99 | | Plus |
Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-10 04:35:55 Download gff for
BO11583.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| CG17376-PB | 1..204 | 17..221 | 99 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-24 03:03:51 Download gff for
BO11583.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| CG17376-RB | 95..309 | 12..228 | 97 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-11 12:24:24 Download gff for
BO11583.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| CG17376-RB | 155..369 | 12..228 | 97 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-11 12:24:24 Download gff for
BO11583.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| 2L | 6800479..6800686 | 12..219 | 97 | | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-24 03:03:51 Download gff for
BO11583.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| arm_2L | 6800479..6800686 | 12..219 | 97 | | Minus |
BO11583.3prime Sequence
233 bp (197 high quality bases) assembled on 2006-04-19
> BO11583.3prime
ATGGTCTAGAAAGCTTGCGAAGCCACATGGATAAGTTGGGGGCGTGTTGT
AGTAGTTCCAGACACGGGGATCGGGAATGCCGCCCTCGGGCAGAGGGGGA
CAGCACATGCCCGGAGCAGGAGAGCACGGGATGGGAGACGGGGCTCCGCA
TGGCGGACTGTGGGGGCCACAGCAGGGTGTTTCATTACAGGGTCCACAGC
ACCCACATCCGTTGCACATGTCGACTGATCACT
BO11583.3prime Blast Records
Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-06 14:26:03
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| CG17376-PB | 204 | CG17376-RB | 1..201 | 219..19 | 980 | 99.5 | Minus |
| CG17377-PC | 864 | CG17377-RC | 388..512 | 174..50 | 275 | 88.8 | Minus |
| CG17376-PA | 138 | CG17376-RA | 1..31 | 219..189 | 130 | 96.7 | Minus |
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-12 04:25:38
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| CG17376-RB | 518 | CG17376-RB | 158..360 | 221..19 | 1000 | 99.5 | Minus |
| CG17376-RC | 784 | CG17376-RC | 98..294 | 221..25 | 970 | 99.5 | Minus |
| CG17377-RD | 907 | CG17377-RD | 487..641 | 174..20 | 430 | 85.2 | Minus |
Blast to na_all.dmel.RELEASE6 performed 2015-02-12 04:25:34
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| 2L | 23513712 | 2L | 6800487..6800683 | 25..221 | 970 | 99.5 | Plus |
| 2L | 23513712 | 2L | 6802059..6802187 | 46..174 | 420 | 88.4 | Plus |
Blast to na_te.dros performed on 2015-02-12 04:25:36 has no hits.
BO11583.3prime Sim4 Records
Sim4 to dmel-all-CDS-r4.3.fasta performed 2007-01-18 05:10:38 Download gff for
BO11583.3prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| CG17376-PB | 1..204 | 15..219 | 98 | | Minus |
Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-10 04:35:53 Download gff for
BO11583.3prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| CG17376-PB | 1..204 | 15..219 | 98 | | Minus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-28 23:25:56 Download gff for
BO11583.3prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| CG17376-RB | 95..309 | 8..224 | 96 | | Minus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-12 07:01:37 Download gff for
BO11583.3prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| CG17376-RB | 155..369 | 8..224 | 96 | | Minus |
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-12 07:01:37 Download gff for
BO11583.3prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| 2L | 6800479..6800686 | 17..224 | 97 | | Plus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-28 23:25:56 Download gff for
BO11583.3prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| arm_2L | 6800479..6800686 | 17..224 | 97 | | Plus |
BO11583.pep Sequence
Translation from 16 to 235
> BO11583.pep
MCNGCGCCGPCNETPCCGPHSPPCGAPSPIPCSPAPGMCCPPLPEGGIPD
PRVWNYYNTPPTYPCGFASFLDH
BO11583.pep Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 05:01:58
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| CG17376-PB | 67 | CG17376-PB | 1..67 | 1..67 | 440 | 100 | Plus |
| CG17376-PC | 91 | CG17376-PC | 1..72 | 1..72 | 434 | 94.4 | Plus |
| CG17377-PD | 181 | CG17377-PD | 109..180 | 2..66 | 336 | 76.4 | Plus |
| CG17377-PE | 207 | CG17377-PE | 109..179 | 2..65 | 330 | 76.1 | Plus |
