Clone BO11663 Report

Search the DGRC for BO11663

Clone and Library Details

Library:BO
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with open reading frames
Original Plate Number:116
Well:63
Vector:pDNR-Dual
Associated Gene/Transcriptng2-RA
Protein status:BO11663.pep: validated full length
Sequenced Size:370

Clone Sequence Records

BO11663.5prime Sequence

368 bp (367 high quality bases) assembled on 2006-04-19

> BO11663.5prime
GAAGTTATCAGTCGACATGAAGATCACCGTGGTACTCGTACTTCTCGCCA
CCTTCCTCGGCTGTGTGATGATCCACGAGTCGGAGGCGTCCACAACCACC
ACGTCCACCTCCGCCTCGGCCACTACCACTACTTCCGCTTCGGCGACCAC
CACTACTTCCGCTTCGGCCACCACCACCACTTCCGCTTCGGCCACCACAA
CAACAGCCTCACCTTCCTCGAGCTCAAAAAAGAAGACTGTCACTCACTAT
AAGCGAAAGGTCAAGAGGCCAAAGAAGGTCAGGAAAATCACAAGGAGAAG
GGGTCTCAGGAGCCGCAATGGTCGCAGCAGTAGAAACCGCAGATCGGAAG
AAGCAAGCTTTCTAGACC

BO11663.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-06 14:27:48
Subject Length Description Subject Range Query Range Score Percent Strand
CG14266-PA 339 ng2-RA 1..336 17..352 1680 100 Plus
CG10781-PA 324 ng1-RA 1..311 17..327 1555 100 Plus
CG10788-PB 441 ng3-RB 91..137 155..201 135 91.4 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-11 02:26:52
Subject Length Description Subject Range Query Range Score Percent Strand
ng2-RA 546 CG14266-RA 37..373 16..352 1685 100 Plus
ng1-RA 523 CG10781-RA 38..349 16..327 1560 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2015-02-11 02:26:49
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 3240199..3240535 352..16 1685 100 Minus
X 23542271 X 3242449..3242760 16..327 1560 100 Plus
X 23542271 X 3240353..3240417 174..110 250 92.3 Minus
X 23542271 X 3240377..3240441 198..134 250 92.3 Minus
X 23542271 X 3242543..3242607 134..198 250 92.3 Plus
X 23542271 X 3242567..3242631 110..174 250 92.3 Plus
Blast to na_te.dros performed on 2015-02-11 02:26:51 has no hits.

BO11663.5prime Sim4 Records

Sim4 to dmel-all-CDS-r4.3.fasta performed 2007-01-18 05:13:00 Download gff for BO11663.5prime
Subject Subject Range Query Range Percent Splice Strand
ng2-PA 1..339 17..356 99   Plus
Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-10 04:39:14 Download gff for BO11663.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14266-PA 1..339 17..356 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-22 23:30:31 Download gff for BO11663.5prime
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 33..377 8..357 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-11 04:55:44 Download gff for BO11663.5prime
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 33..377 8..357 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-11 04:55:44 Download gff for BO11663.5prime
Subject Subject Range Query Range Percent Splice Strand
X 3240195..3240539 8..357 98   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-22 23:30:31 Download gff for BO11663.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 3134228..3134572 8..357 98   Minus

BO11663.3prime Sequence

368 bp (367 high quality bases) assembled on 2006-04-19

> BO11663.3prime
ATGGTCTAGAAAGCTTGCTTCTTCCGATCTGCGGTTTCTACTGCTGCGAC
CATTGCGGCTCCTGAGACCCCTTCTCCTTGTGATTTTCCTGACCTTCTTT
GGCCTCTTGACCTTTCGCTTATAGTGAGTGACAGTCTTCTTTTTTGAGCT
CGAGGAAGGTGAGGCTGTTGTTGTGGTGGCCGAAGCGGAAGTGGTGGTGG
TGGCCGAAGCGGAAGTAGTGGTGGTCGCCGAAGCGGAAGTAGTGGTAGTG
GCCGAGGCGGAGGTGGACGTGGTGGTTGTGGACGCCTCCGACTCGTGGAT
CATCACACAGCCGAGGAAGGTGGCGAGAAGTACGAGTACCACGGTGATCT
TCATGTCGACTGATAACT

BO11663.3prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-06 14:27:47
Subject Length Description Subject Range Query Range Score Percent Strand
CG14266-PA 339 ng2-RA 1..336 354..19 1680 100 Minus
CG10781-PA 324 ng1-RA 1..311 354..44 1555 100 Minus
CG10788-PB 441 ng3-RB 91..137 216..170 135 91.4 Minus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-13 15:44:22
Subject Length Description Subject Range Query Range Score Percent Strand
ng2-RA 546 CG14266-RA 37..373 355..19 1685 100 Minus
ng1-RA 523 CG10781-RA 38..349 355..44 1560 100 Minus
Blast to na_all.dmel.RELEASE6 performed 2015-02-13 15:44:19
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 3240199..3240535 19..355 1685 100 Plus
X 23542271 X 3242449..3242760 355..44 1560 100 Minus
X 23542271 X 3240353..3240417 197..261 250 92.3 Plus
X 23542271 X 3240377..3240441 173..237 250 92.3 Plus
X 23542271 X 3242543..3242607 237..173 250 92.3 Minus
X 23542271 X 3242567..3242631 261..197 250 92.3 Minus
Blast to na_te.dros performed on 2015-02-13 15:44:21 has no hits.

BO11663.3prime Sim4 Records

Sim4 to dmel-all-CDS-r4.3.fasta performed 2007-01-18 05:12:59 Download gff for BO11663.3prime
Subject Subject Range Query Range Percent Splice Strand
ng2-PA 1..339 15..354 99   Minus
Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-10 04:39:12 Download gff for BO11663.3prime
Subject Subject Range Query Range Percent Splice Strand
CG14266-PA 1..339 15..354 99   Minus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-09-03 15:44:32 Download gff for BO11663.3prime
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 33..377 14..363 98   Minus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-13 17:06:32 Download gff for BO11663.3prime
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 33..377 14..363 98   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-13 17:06:32 Download gff for BO11663.3prime
Subject Subject Range Query Range Percent Splice Strand
X 3240195..3240539 14..363 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-09-03 15:44:32 Download gff for BO11663.3prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 3134228..3134572 14..363 98   Plus

BO11663.complete Sequence

370 bp assembled on 2006-10-11

GenBank Submission: FJ632147

> BO11663.complete
GAAGTTATCAGTCGACATGAAGATCACCGTGGTACTCGTACTTCTCGCCA
CCTTCCTCGGCTGTGTGATGATCCACGAGTCGGAGGCGTCCACAACCACC
ACGTCCACCTCCGCCTCGGCCACTACCACTACTTCCGCTTCGGCGACCAC
CACTACTTCCGCTTCGGCCACCACCACCACTTCCGCTTCGGCCACCACAA
CAACAGCCTCACCTTCCTCGAGCTCAAAAAAGAAGACTGTCACTCACTAT
AAGCGAAAGGTCAAGAGGCCAAAGAAGGTCAGGAAAATCACAAGGAGAAG
GGGTCTCAGGAGCCGCAATGGTCGCAGCAGTAGAAACCGCAGATCGGAAG
AAGCAAGCTTTCTAGACCAT

BO11663.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-27 16:56:19
Subject Length Description Subject Range Query Range Score Percent Strand
ng2-RA 339 CG14266-PA 1..336 17..352 1680 100 Plus
ng1-RA 324 CG10781-PA 1..311 17..327 1555 100 Plus
ng2-RA 339 CG14266-PA 94..158 134..198 250 92.3 Plus
ng2-RA 339 CG14266-PA 118..182 110..174 250 92.3 Plus
ng1-RA 324 CG10781-PA 94..158 134..198 250 92.3 Plus
ng1-RA 324 CG10781-PA 118..182 110..174 250 92.3 Plus
ng3-RB 441 CG10788-PB 91..137 155..201 175 91.5 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 16:56:20
Subject Length Description Subject Range Query Range Score Percent Strand
ng2-RA 546 CG14266-RA 37..373 16..352 1685 100 Plus
ng1-RA 523 CG10781-RA 38..349 16..327 1560 100 Plus
ng2-RA 546 CG14266-RA 131..195 134..198 250 92.3 Plus
ng2-RA 546 CG14266-RA 155..219 110..174 250 92.3 Plus
ng1-RA 523 CG10781-RA 132..196 134..198 250 92.3 Plus
ng1-RA 523 CG10781-RA 156..220 110..174 250 92.3 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 16:56:17
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 3240199..3240535 352..16 1685 100 Minus
X 23542271 X 3242449..3242760 16..327 1560 100 Plus
X 23542271 X 3240353..3240417 174..110 250 92.3 Minus
X 23542271 X 3240377..3240441 198..134 250 92.3 Minus
X 23542271 X 3242543..3242607 134..198 250 92.3 Plus
X 23542271 X 3242567..3242631 110..174 250 92.3 Plus
Blast to na_te.dros performed on 2014-11-27 16:56:18 has no hits.

BO11663.complete Sim4 Records

Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 14:00:58 Download gff for BO11663.complete
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 1..339 17..356 99   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-11 05:13:36 Download gff for BO11663.complete
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 33..377 8..357 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 19:00:52 Download gff for BO11663.complete
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 38..373 17..354 99   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 14:00:59 Download gff for BO11663.complete
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 33..377 8..357 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 17:30:31 Download gff for BO11663.complete
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 38..373 17..354 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 17:30:31 Download gff for BO11663.complete
Subject Subject Range Query Range Percent Splice Strand
X 3240197..3240534 17..354 99   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 19:00:52 Download gff for BO11663.complete
Subject Subject Range Query Range Percent Splice Strand
arm_X 3134230..3134567 17..354 99   Minus

BO11663.pep Sequence

Translation from 16 to 370

> BO11663.pep
MKITVVLVLLATFLGCVMIHESEASTTTTSTSASATTTTSASATTTTSAS
ATTTTSASATTTTASPSSSSKKKTVTHYKRKVKRPKKVRKITRRRGLRSR
NGRSSRNRRSEEASFLDH

BO11663.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 20:54:10
Subject Length Description Subject Range Query Range Score Percent Strand
ng2-PA 112 CG14266-PA 1..112 1..112 536 100 Plus
ng1-PA 107 CG10781-PA 1..105 1..105 496 99 Plus
CG33267-PB 94 CG33267-PB 1..90 1..95 257 62.1 Plus
ng3-PB 146 CG10788-PB 1..119 1..114 254 53.7 Plus
CG7377-PA 94 CG7377-PA 1..90 1..95 238 60.4 Plus