Clone BO15871 Report

Search the DGRC for BO15871

Clone and Library Details

Library:BO
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with open reading frames
Original Plate Number:158
Well:71
Vector:pDNR-Dual
Associated Gene/Transcript
Protein status:BO15871.pep:
Sequenced Size:208

Clone Sequence Records

BO15871.3prime Sequence

206 bp (206 high quality bases) assembled on 2006-06-02

> BO15871.3prime
ATGGTCTAGAAAGCTTGCTTTTCTGCACAACGCGAAACGATGACGAAGTG
TTGTGGTGGGTGGTGGCGGTAATGGTAATGATGGTGGTGGTGCGCTGGTT
GTGTGCCTTCTGTTGTTGTTTTCCTGTTCTCCGCCGTCGCTGGTGGGGGT
TGGTTTTCTTTTCTTTGCCTCCTTTCCCCTGGTCGCACTCATGTCGACTG
ATAACT

BO15871.3prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed on 2007-05-06 15:41:32 has no hits.
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-13 14:11:08
Subject Length Description Subject Range Query Range Score Percent Strand
l(3)neo38-RL 2247 CG6930-RL 341..514 192..19 855 99.4 Minus
l(3)neo38-RD 4963 CG6930-RD 881..1054 192..19 855 99.4 Minus
l(3)neo38-RC 2247 CG6930-RC 341..514 192..19 855 99.4 Minus
Blast to na_all.dmel.RELEASE6 performed 2015-02-13 14:11:07
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 11777839..11778012 19..192 855 99.4 Plus
Blast to na_te.dros performed on 2015-02-13 14:11:08 has no hits.

BO15871.3prime Sim4 Records

Sim4 to dmel-all-CDS-r4.3.fasta performed 2007-01-18 06:55:33 Download gff for BO15871.3prime
Subject Subject Range Query Range Percent Splice Strand
CG31364-PA 1..177 15..192 98   Minus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-09-03 03:02:20 Download gff for BO15871.3prime
Subject Subject Range Query Range Percent Splice Strand
l(3)neo38-RC 336..519 11..199 95   Minus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-13 15:54:26 Download gff for BO15871.3prime
Subject Subject Range Query Range Percent Splice Strand
l(3)neo38-RC 336..519 11..199 95   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-13 15:54:26 Download gff for BO15871.3prime
Subject Subject Range Query Range Percent Splice Strand
3R 11777834..11778017 11..199 95   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-09-03 03:02:20 Download gff for BO15871.3prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 7603556..7603739 11..199 95   Plus

BO15871.5prime Sequence

206 bp (206 high quality bases) assembled on 2006-05-30

> BO15871.5prime
GAAGTTATCAGTCGACATGAGTGCGACCAGGGGAAAGGAGGCAAAGAAAA
GAAAACCAACCCCCACCAGCGACGGCGGAGAACAGGAAAACAACAACAGA
AGGCACACAACCAGCGCACCACCACCATCATTACCATTACCGCCACCACC
CACCACAACACTTCGTCATCGTTTCGCGTTGTGCAGAAAAGCAAGCTTTC
TAGACC

BO15871.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed on 2007-05-06 15:41:33 has no hits.
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-11 13:12:12
Subject Length Description Subject Range Query Range Score Percent Strand
l(3)neo38-RL 2247 CG6930-RL 341..514 17..190 855 99.4 Plus
l(3)neo38-RD 4963 CG6930-RD 881..1054 17..190 855 99.4 Plus
l(3)neo38-RC 2247 CG6930-RC 341..514 17..190 855 99.4 Plus
Blast to na_all.dmel.RELEASE6 performed 2015-02-11 13:12:10
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 11777839..11778012 190..17 855 99.4 Minus
Blast to na_te.dros performed on 2015-02-11 13:12:11 has no hits.

BO15871.5prime Sim4 Records

Sim4 to dmel-all-CDS-r4.3.fasta performed 2007-01-18 06:55:34 Download gff for BO15871.5prime
Subject Subject Range Query Range Percent Splice Strand
CG31364-PA 1..177 17..194 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-25 04:08:10 Download gff for BO15871.5prime
Subject Subject Range Query Range Percent Splice Strand
l(3)neo38-RC 336..519 10..198 95   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-11 17:48:03 Download gff for BO15871.5prime
Subject Subject Range Query Range Percent Splice Strand
l(3)neo38-RC 336..519 10..198 95   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-11 17:48:03 Download gff for BO15871.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 11777834..11778017 10..198 95   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-25 04:08:10 Download gff for BO15871.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 7603556..7603739 10..198 95   Minus

BO15871.complete Sequence

208 bp assembled on 2006-12-18

> BO15871.complete
GAAGTTATCAGTCGACATGAGTGCGACCAGGGGAAAGGAGGCAAAGAAAA
GAAAACCAACCCCCACCAGCGACGGCGGAGAACAGGAAAACAACAACAGA
AGGCACACAACCAGCGCACCACCACCATCATTACCATTACCGCCACCACC
CACCACAACACTTCGTCATCGTTTCGCGTTGTGCAGAAAAGCAAGCTTTC
TAGACCAT

BO15871.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed on 2014-11-27 08:45:21 has no hits.
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 08:45:23
Subject Length Description Subject Range Query Range Score Percent Strand
l(3)neo38-RL 2247 CG6930-RL 341..514 17..190 855 99.4 Plus
l(3)neo38-RD 4963 CG6930-RD 881..1054 17..190 855 99.4 Plus
l(3)neo38-RC 2247 CG6930-RC 341..514 17..190 855 99.4 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 08:45:18
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 11777839..11778012 190..17 855 99.4 Minus
Blast to na_te.dros performed on 2014-11-27 08:45:20 has no hits.

BO15871.complete Sim4 Records

Sim4 to dmel-all-CDS-r5.9.fasta performed on 2008-07-21 22:57:01 has no hits.
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-11 07:29:35 Download gff for BO15871.complete
Subject Subject Range Query Range Percent Splice Strand
l(3)neo38-RB 728..911 10..198 95   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 10:01:39 Download gff for BO15871.complete
Subject Subject Range Query Range Percent Splice Strand
l(3)neo38-RC 341..510 17..186 99   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 22:57:01 Download gff for BO15871.complete
Subject Subject Range Query Range Percent Splice Strand
l(3)neo38-RB 728..911 10..198 95   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 09:25:52 Download gff for BO15871.complete
Subject Subject Range Query Range Percent Splice Strand
l(3)neo38-RC 341..510 17..186 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 09:25:52 Download gff for BO15871.complete
Subject Subject Range Query Range Percent Splice Strand
3R 11777843..11778012 17..186 99   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 10:01:39 Download gff for BO15871.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3R 7603565..7603734 17..186 99   Minus

BO15871.pep Sequence

Translation from 16 to 208

> BO15871.pep
MSATRGKEAKKRKPTPTSDGGEQENNNRRHTTSAPPPSLPLPPPPTTTLR
HRFALCRKASFLDH
Sequence BO15871.pep has no blast hits.