Clone BO15966 Report

Search the DGRC for BO15966

Clone and Library Details

Library:BO
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with open reading frames
Original Plate Number:159
Well:66
Vector:pDNR-Dual
Associated Gene/TranscriptCG9284-RA
Protein status:BO15966.pep: validated full length
Sequenced Size:238

Clone Sequence Records

BO15966.3prime Sequence

236 bp (236 high quality bases) assembled on 2006-06-02

> BO15966.3prime
ATGGTCTAGAAAGCTTGCACCACCGTGGTGATCCAAAAATACACGGATAG
CCTTATGTCCTCTGCTCGTTTCTCTGACGCCTCCTCTGGCAGTGGAAACA
ACCGCAGTTGCGGCCAGATGACAAGGACTTACGCCGTCCACCGCACCACT
ACCATTGGAGGACATCGTTTTTGGGGCGTCTTTGGTATTCCTCGATGATG
CACTGATCTCGTTCGAATTCATGTCGACTGATAACT

BO15966.3prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-06 15:42:34
Subject Length Description Subject Range Query Range Score Percent Strand
CG9284-PA 207 CG9284-RA 1..204 222..19 1020 100 Minus
CG9284-PB 207 CG9284-RB 1..204 222..19 1020 100 Minus
Blast to dmel-all-transcript-r6.02.fasta performed on 2015-02-11 11:51:08 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2015-02-11 11:51:04
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 21803640..21803844 223..19 1025 100 Minus
Blast to na_te.dros performed on 2015-02-11 11:51:06 has no hits.

BO15966.3prime Sim4 Records

Sim4 to dmel-all-CDS-r4.3.fasta performed 2007-01-18 06:57:05 Download gff for BO15966.3prime
Subject Subject Range Query Range Percent Splice Strand
CG9284-PA 1..207 18..222 99   Minus
Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-10 07:02:59 Download gff for BO15966.3prime
Subject Subject Range Query Range Percent Splice Strand
CG9284-PB 1..207 18..222 99   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-11 13:19:27 Download gff for BO15966.3prime
Subject Subject Range Query Range Percent Splice Strand
2R 21803636..21803844 19..231 98   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-11 13:19:27 Download gff for BO15966.3prime
Subject Subject Range Query Range Percent Splice Strand
2R 21803636..21803844 19..231 98   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-24 20:33:08 Download gff for BO15966.3prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 17691141..17691349 19..231 98   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-24 20:33:08 Download gff for BO15966.3prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 17691141..17691349 19..231 98   Minus

BO15966.5prime Sequence

236 bp (236 high quality bases) assembled on 2006-06-02

> BO15966.5prime
GAAGTTATCAGTCGACATGAATTCGAACGAGATCAGTGCATCATCGAGGA
ATACCAAAGACGCCCCAAAAACGATGTCCTCCAATGGTAGTGGTGCGGTG
GACGGCGTAAGTCCTTGTCATCTGGCCGCAACTGCGGTTGTTTCCACTGC
CAGAGGAGGCGTCAGAGAAACGAGCAGAGGACATAAGGCTATCCGTGTAT
TTTTGGATCACCACGGTGGTGCAAGCTTTCTAGACC

BO15966.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-06 15:42:35
Subject Length Description Subject Range Query Range Score Percent Strand
CG9284-PA 207 CG9284-RA 1..204 17..220 1020 100 Plus
CG9284-PB 207 CG9284-RB 1..204 17..220 1020 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed on 2015-02-12 19:41:07 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2015-02-12 19:41:03
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 21803640..21803844 16..220 1025 100 Plus
Blast to na_te.dros performed on 2015-02-12 19:41:05 has no hits.

BO15966.5prime Sim4 Records

Sim4 to dmel-all-CDS-r4.3.fasta performed 2007-01-18 06:57:06 Download gff for BO15966.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9284-PA 1..207 17..221 99   Plus
Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-10 07:03:00 Download gff for BO15966.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9284-PB 1..207 17..221 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-13 00:11:44 Download gff for BO15966.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 21803636..21803844 8..220 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-13 00:11:44 Download gff for BO15966.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 21803636..21803844 8..220 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-31 10:30:55 Download gff for BO15966.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 17691141..17691349 8..220 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-31 10:30:55 Download gff for BO15966.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 17691141..17691349 8..220 98   Plus

BO15966.complete Sequence

238 bp (238 high quality bases) assembled on 2006-08-24

GenBank Submission: FJ633643

> BO15966.complete
GAAGTTATCAGTCGACATGAATTCGAACGAGATCAGTGCATCATCGAGGA
ATACCAAAGACGCCCCAAAAACGATGTCCTCCAATGGTAGTGGTGCGGTG
GACGGCGTAAGTCCTTGTCATCTGGCCGCAACTGCGGTTGTTTCCACTGC
CAGAGGAGGCGTCAGAGAAACGAGCAGAGGACATAAGGCTATCCGTGTAT
TTTTGGATCACCACGGTGGTGCAAGCTTTCTAGACCAT

BO15966.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed on 2014-11-26 16:13:24 has no hits.
Blast to dmel-all-transcript-r6.02.fasta performed on 2014-11-26 16:13:25 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:13:22
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 21803640..21803844 16..220 1025 100 Plus
Blast to na_te.dros performed on 2014-11-26 16:13:23 has no hits.

BO15966.complete Sim4 Records

Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 14:04:46 Download gff for BO15966.complete
Subject Subject Range Query Range Percent Splice Strand
CG9284-RB 1..207 17..221 99   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-11 05:19:19 Download gff for BO15966.complete
Subject Subject Range Query Range Percent Splice Strand
CG9284-RB 165..373 8..220 98   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 14:04:46 Download gff for BO15966.complete
Subject Subject Range Query Range Percent Splice Strand
CG9284-RB 165..373 8..220 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:13:58 Download gff for BO15966.complete
Subject Subject Range Query Range Percent Splice Strand
2R 21803641..21803844 17..222 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:13:58 Download gff for BO15966.complete
Subject Subject Range Query Range Percent Splice Strand
2R 21803641..21803844 17..222 99   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:55:20 Download gff for BO15966.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2R 17691146..17691349 17..222 99   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:55:20 Download gff for BO15966.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2R 17691146..17691349 17..222 99   Plus

BO15966.pep Sequence

Translation from 16 to 238

> BO15966.pep
MNSNEISASSRNTKDAPKTMSSNGSGAVDGVSPCHLAATAVVSTARGGVR
ETSRGHKAIRVFLDHHGGASFLDH
Sequence BO15966.pep has no blast hits.