Clone Sequence Records
BO16647.3prime Sequence
248 bp (248 high quality bases) assembled on 2006-10-13
> BO16647.3prime
ATGGTCTAGAAAGCTTGCAAAAGGACAGCACCGCTGAAGGCCATTTCGTT
TTTCCATAGTGCCACAGCACGGTCCACAGGGTCCGCAAGGGCCACAACGA
GGTCCACAGGGGCCACAGCAGGGCCCGCAAGGTCCACAACAGGGTCCACA
ACAGGGTCCACAACAGGGTCCACAACAGGGTCCGCAACACGGTCCACAGG
GTCCGCAGCAAGGTCCGCCCGGTGCACAGCCCATGTCGACTGATAACT
BO16647.3prime Blast Records
Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-09 16:23:47
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG17935-PA | 219 | Mst84Dd-RA | 1..216 | 234..19 | 1080 | 100 | Minus |
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-12 03:30:24
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Mst84Dd-RA | 415 | CG17935-RA | 104..321 | 236..19 | 1090 | 100 | Minus |
Mst84Dc-RB | 359 | CG17945-RB | 87..196 | 210..101 | 215 | 80.5 | Minus |
Mst84Dc-RA | 363 | CG17945-RA | 91..200 | 210..101 | 215 | 80.5 | Minus |
Blast to na_all.dmel.RELEASE6 performed 2015-02-12 03:30:23
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
3R | 32079331 | 3R | 7363401..7363618 | 19..236 | 1090 | 100 | Plus |
Blast to na_te.dros performed on 2015-02-12 03:30:24 has no hits.
BO16647.3prime Sim4 Records
Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 12:54:28 Download gff for
BO16647.3prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG17935-PA | 1..219 | 18..234 | 99 | | Minus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-28 21:25:25 Download gff for
BO16647.3prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Mst84Dd-RA | 104..326 | 12..236 | 98 | | Minus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-12 06:36:12 Download gff for
BO16647.3prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Mst84Dd-RA | 104..326 | 12..236 | 98 | | Minus |
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-12 06:36:12 Download gff for
BO16647.3prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3R | 7363396..7363618 | 12..236 | 98 | | Plus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-28 21:25:25 Download gff for
BO16647.3prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_3R | 3189118..3189340 | 12..236 | 98 | | Plus |
BO16647.complete Sequence
250 bp assembled on 2011-06-28
> BO16647.complete
GAAGTTATCAGTCGACATGGGCTGTGCACCGGGCGGACCTTGCTGCGGAC
CCTGTGGACCGTGTTGCGGACCCTGTTGTGGACCCTGTTGTGGACCCTGT
TGTGGACCCTGTTGTGGACCTTGCGGGCCCTGCTGTGGCCCCTGTGGACC
TCGTTGTGGCCCTTGCGGACCCTGTGGACCGTGCTGTGGCACTATGGAAA
AACGAAATGGCCTTCAGCGGTGCTGTCCTTTTGCAAGCTTTCTAGACCAT
BO16647.complete Blast Records
Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-26 16:08:30
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Mst84Dd-RA | 219 | CG17935-PA | 1..216 | 17..232 | 1080 | 100 | Plus |
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:08:31
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Mst84Dd-RA | 415 | CG17935-RA | 104..321 | 15..232 | 1090 | 100 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:08:28
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
3R | 32079331 | 3R | 7363401..7363618 | 232..15 | 1090 | 100 | Minus |
Blast to na_te.dros performed on 2014-11-26 16:08:29 has no hits.
BO16647.complete Sim4 Records
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-06-28 12:16:11 Download gff for
BO16647.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Mst84Dd-RA | 106..321 | 17..234 | 99 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:53:15 Download gff for
BO16647.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Mst84Dd-RA | 106..321 | 17..234 | 99 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:12:09 Download gff for
BO16647.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Mst84Dd-RA | 106..321 | 17..234 | 99 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:12:09 Download gff for
BO16647.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3R | 7363397..7363616 | 17..234 | 99 | | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:53:15 Download gff for
BO16647.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_3R | 3189119..3189338 | 17..234 | 99 | | Minus |
BO16647.pep Sequence
Translation from 16 to 250
> BO16647.pep
MGCAPGGPCCGPCGPCCGPCCGPCCGPCCGPCCGPCGPCCGPCGPRCGPC
GPCGPCCGTMEKRNGLQRCCPFASFLDH
BO16647.pep Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 12:46:43
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Mst84Dd-PA | 72 | CG17935-PA | 1..72 | 1..72 | 510 | 100 | Plus |
Mst84Db-PA | 74 | CG17934-PA | 9..66 | 3..58 | 265 | 71.7 | Plus |
Mst84Dc-PB | 55 | CG17945-PB | 2..51 | 9..58 | 259 | 80.8 | Plus |
Mst84Dc-PA | 55 | CG17945-PA | 2..51 | 9..58 | 259 | 80.8 | Plus |
Mst84Db-PA | 74 | CG17934-PA | 12..73 | 3..58 | 257 | 70.3 | Plus |
Mst87F-PB | 56 | CG17956-PB | 2..52 | 9..58 | 257 | 79.2 | Plus |
Mst84Db-PA | 74 | CG17934-PA | 2..65 | 9..70 | 224 | 61.2 | Plus |
Mst84Dc-PB | 55 | CG17945-PB | 16..53 | 7..43 | 201 | 79.5 | Plus |
Mst84Dc-PA | 55 | CG17945-PA | 16..53 | 7..43 | 201 | 79.5 | Plus |
Mst84Dc-PB | 55 | CG17945-PB | 1..53 | 1..50 | 195 | 63.6 | Plus |
Mst84Dc-PA | 55 | CG17945-PA | 1..53 | 1..50 | 195 | 63.6 | Plus |
Mst84Dc-PB | 55 | CG17945-PB | 2..48 | 32..74 | 140 | 57.4 | Plus |
Mst84Dc-PA | 55 | CG17945-PA | 2..48 | 32..74 | 140 | 57.4 | Plus |