Clone BO16647 Report

Search the DGRC for BO16647

Clone and Library Details

Library:BO
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with open reading frames
Original Plate Number:166
Well:47
Vector:pDNR-Dual
Associated Gene/Transcript
Protein status:BO16647.pep: Inserted from web
Sequenced Size:250

Clone Sequence Records

BO16647.3prime Sequence

248 bp (248 high quality bases) assembled on 2006-10-13

> BO16647.3prime
ATGGTCTAGAAAGCTTGCAAAAGGACAGCACCGCTGAAGGCCATTTCGTT
TTTCCATAGTGCCACAGCACGGTCCACAGGGTCCGCAAGGGCCACAACGA
GGTCCACAGGGGCCACAGCAGGGCCCGCAAGGTCCACAACAGGGTCCACA
ACAGGGTCCACAACAGGGTCCACAACAGGGTCCGCAACACGGTCCACAGG
GTCCGCAGCAAGGTCCGCCCGGTGCACAGCCCATGTCGACTGATAACT

BO16647.3prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-09 16:23:47
Subject Length Description Subject Range Query Range Score Percent Strand
CG17935-PA 219 Mst84Dd-RA 1..216 234..19 1080 100 Minus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-12 03:30:24
Subject Length Description Subject Range Query Range Score Percent Strand
Mst84Dd-RA 415 CG17935-RA 104..321 236..19 1090 100 Minus
Mst84Dc-RB 359 CG17945-RB 87..196 210..101 215 80.5 Minus
Mst84Dc-RA 363 CG17945-RA 91..200 210..101 215 80.5 Minus
Blast to na_all.dmel.RELEASE6 performed 2015-02-12 03:30:23
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 7363401..7363618 19..236 1090 100 Plus
Blast to na_te.dros performed on 2015-02-12 03:30:24 has no hits.

BO16647.3prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 12:54:28 Download gff for BO16647.3prime
Subject Subject Range Query Range Percent Splice Strand
CG17935-PA 1..219 18..234 99   Minus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-28 21:25:25 Download gff for BO16647.3prime
Subject Subject Range Query Range Percent Splice Strand
Mst84Dd-RA 104..326 12..236 98   Minus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-12 06:36:12 Download gff for BO16647.3prime
Subject Subject Range Query Range Percent Splice Strand
Mst84Dd-RA 104..326 12..236 98   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-12 06:36:12 Download gff for BO16647.3prime
Subject Subject Range Query Range Percent Splice Strand
3R 7363396..7363618 12..236 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-28 21:25:25 Download gff for BO16647.3prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 3189118..3189340 12..236 98   Plus

BO16647.complete Sequence

250 bp assembled on 2011-06-28

> BO16647.complete
GAAGTTATCAGTCGACATGGGCTGTGCACCGGGCGGACCTTGCTGCGGAC
CCTGTGGACCGTGTTGCGGACCCTGTTGTGGACCCTGTTGTGGACCCTGT
TGTGGACCCTGTTGTGGACCTTGCGGGCCCTGCTGTGGCCCCTGTGGACC
TCGTTGTGGCCCTTGCGGACCCTGTGGACCGTGCTGTGGCACTATGGAAA
AACGAAATGGCCTTCAGCGGTGCTGTCCTTTTGCAAGCTTTCTAGACCAT

BO16647.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-26 16:08:30
Subject Length Description Subject Range Query Range Score Percent Strand
Mst84Dd-RA 219 CG17935-PA 1..216 17..232 1080 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:08:31
Subject Length Description Subject Range Query Range Score Percent Strand
Mst84Dd-RA 415 CG17935-RA 104..321 15..232 1090 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:08:28
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 7363401..7363618 232..15 1090 100 Minus
Blast to na_te.dros performed on 2014-11-26 16:08:29 has no hits.

BO16647.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-06-28 12:16:11 Download gff for BO16647.complete
Subject Subject Range Query Range Percent Splice Strand
Mst84Dd-RA 106..321 17..234 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:53:15 Download gff for BO16647.complete
Subject Subject Range Query Range Percent Splice Strand
Mst84Dd-RA 106..321 17..234 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:12:09 Download gff for BO16647.complete
Subject Subject Range Query Range Percent Splice Strand
Mst84Dd-RA 106..321 17..234 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:12:09 Download gff for BO16647.complete
Subject Subject Range Query Range Percent Splice Strand
3R 7363397..7363616 17..234 99   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:53:15 Download gff for BO16647.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3R 3189119..3189338 17..234 99   Minus

BO16647.pep Sequence

Translation from 16 to 250

> BO16647.pep
MGCAPGGPCCGPCGPCCGPCCGPCCGPCCGPCCGPCGPCCGPCGPRCGPC
GPCGPCCGTMEKRNGLQRCCPFASFLDH

BO16647.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 12:46:43
Subject Length Description Subject Range Query Range Score Percent Strand
Mst84Dd-PA 72 CG17935-PA 1..72 1..72 510 100 Plus
Mst84Db-PA 74 CG17934-PA 9..66 3..58 265 71.7 Plus
Mst84Dc-PB 55 CG17945-PB 2..51 9..58 259 80.8 Plus
Mst84Dc-PA 55 CG17945-PA 2..51 9..58 259 80.8 Plus
Mst84Db-PA 74 CG17934-PA 12..73 3..58 257 70.3 Plus
Mst87F-PB 56 CG17956-PB 2..52 9..58 257 79.2 Plus
Mst84Db-PA 74 CG17934-PA 2..65 9..70 224 61.2 Plus
Mst84Dc-PB 55 CG17945-PB 16..53 7..43 201 79.5 Plus
Mst84Dc-PA 55 CG17945-PA 16..53 7..43 201 79.5 Plus
Mst84Dc-PB 55 CG17945-PB 1..53 1..50 195 63.6 Plus
Mst84Dc-PA 55 CG17945-PA 1..53 1..50 195 63.6 Plus
Mst84Dc-PB 55 CG17945-PB 2..48 32..74 140 57.4 Plus
Mst84Dc-PA 55 CG17945-PA 2..48 32..74 140 57.4 Plus