Clone BO16831 Report

Search the DGRC for BO16831

Clone and Library Details

Library:BO
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with open reading frames
Original Plate Number:168
Well:31
Vector:pDNR-Dual
Associated Gene/TranscriptCG30430-RA
Protein status:BO16831.pep:
Sequenced Size:187

Clone Sequence Records

BO16831.3prime Sequence

185 bp (185 high quality bases) assembled on 2006-10-13

> BO16831.3prime
ATGGTCTAGAAAGCTTGCACAAGACGGTCCGCAGCTGCTGCAGCATCCGC
CCCCGCAGCAAGGTCCACATGGTCCACTATAGAATCCGCATCGTGGTCCA
AAACAACGGCCACTAAAGCAGGGGCTACAGCAAGGGTAGTAGCAAGTTCC
ACAGCAGGGCCCGCAACACATGTCGACTGATAACT

BO16831.3prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-09 16:39:15
Subject Length Description Subject Range Query Range Score Percent Strand
CG30430-PA 156 CG30430-RA 1..153 171..19 765 100 Minus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-08 11:30:30
Subject Length Description Subject Range Query Range Score Percent Strand
CG30430-RB 355 CG30430-RB 97..249 171..19 765 100 Minus
CG30430-RA 498 CG30430-RA 124..276 171..19 765 100 Minus
Blast to na_all.dmel.RELEASE6 performed 2015-02-08 11:30:23
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 25129611..25129763 171..19 765 100 Minus
Blast to na_te.dros performed on 2015-02-08 11:30:27 has no hits.

BO16831.3prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 12:57:26 Download gff for BO16831.3prime
Subject Subject Range Query Range Percent Splice Strand
CG30430-PA 1..156 15..171 98   Minus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-11 23:34:28 Download gff for BO16831.3prime
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 119..282 10..176 96   Minus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-08 13:40:09 Download gff for BO16831.3prime
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 119..282 10..176 96   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-08 13:40:09 Download gff for BO16831.3prime
Subject Subject Range Query Range Percent Splice Strand
2R 25129606..25129769 10..176 96   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-11 23:34:28 Download gff for BO16831.3prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 21017129..21017292 10..176 96   Minus

BO16831.5prime Sequence

185 bp (185 high quality bases) assembled on 2006-10-13

> BO16831.5prime
GAAGTTATCAGTCGACATGTGTTGCGGGCCCTGCTGTGGAACTTGCTACT
ACCCTTGCTGTAGCCCCTGCTTTAGTGGCCGTTGTTTTGGACCACGATGC
GGATTCTATAGTGGACCATGTGGACCTTGCTGCGGGGGCGGATGCTGCAG
CAGCTGCGGACCGTCTTGTGCAAGCTTTCTAGACC

BO16831.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-09 16:39:22
Subject Length Description Subject Range Query Range Score Percent Strand
CG30430-PA 156 CG30430-RA 1..153 17..169 765 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-10 23:45:16
Subject Length Description Subject Range Query Range Score Percent Strand
CG30430-RB 355 CG30430-RB 97..249 17..169 765 100 Plus
CG30430-RA 498 CG30430-RA 124..276 17..169 765 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2015-02-10 23:45:13
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 25129611..25129763 17..169 765 100 Plus
Blast to na_te.dros performed on 2015-02-10 23:45:14 has no hits.

BO16831.5prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 12:57:27 Download gff for BO16831.5prime
Subject Subject Range Query Range Percent Splice Strand
CG30430-PA 1..156 17..173 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-21 08:05:55 Download gff for BO16831.5prime
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 119..282 12..178 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-11 00:58:51 Download gff for BO16831.5prime
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 119..282 12..178 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-11 00:58:51 Download gff for BO16831.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 25129606..25129769 12..178 96   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-21 08:05:55 Download gff for BO16831.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 21017129..21017292 12..178 96   Plus

BO16831.complete Sequence

187 bp assembled on 2007-12-19

GenBank Submission: FJ633935

> BO16831.complete
GAAGTTATCAGTCGACATGTGTTGCGGGCCCTGCTGTGGAACTTGCTACT
ACCCTTGCTGTAGCCCCTGCTTTAGTGGCCGTTGTTTTGGACCACGATGC
GGATTCTATAGTGGACCATGTGGACCTTGCTGCGGGGGCGGATGCTGCAG
CAGCTGCGGACCGTCTTGTGCAAGCTTTCTAGACCAT

BO16831.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-27 16:35:36
Subject Length Description Subject Range Query Range Score Percent Strand
CG30430-RB 156 CG30430-PB 1..153 17..169 765 100 Plus
CG30430-RA 156 CG30430-PA 1..153 17..169 765 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 16:35:37
Subject Length Description Subject Range Query Range Score Percent Strand
CG30430-RB 355 CG30430-RB 97..249 17..169 765 100 Plus
CG30430-RA 498 CG30430-RA 124..276 17..169 765 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 16:35:34
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 25129611..25129763 17..169 765 100 Plus
Blast to na_te.dros performed on 2014-11-27 16:35:35 has no hits.

BO16831.complete Sim4 Records

Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 14:03:20 Download gff for BO16831.complete
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 1..156 17..173 98   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2009-07-28 15:36:23 Download gff for BO16831.complete
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 124..276 17..171 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 18:53:33 Download gff for BO16831.complete
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 124..276 17..171 98   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 14:03:21 Download gff for BO16831.complete
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 119..282 12..178 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 17:22:06 Download gff for BO16831.complete
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 124..276 17..171 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 17:22:06 Download gff for BO16831.complete
Subject Subject Range Query Range Percent Splice Strand
2R 25129611..25129763 17..171 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 18:53:33 Download gff for BO16831.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2R 21017134..21017286 17..171 98   Plus

BO16831.pep Sequence

Translation from 16 to 187

> BO16831.pep
MCCGPCCGTCYYPCCSPCFSGRCFGPRCGFYSGPCGPCCGGGCCSSCGPS
CASFLDH

BO16831.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 02:22:42
Subject Length Description Subject Range Query Range Score Percent Strand
CG30430-PB 51 CG30430-PB 1..51 1..51 351 100 Plus
CG30430-PA 51 CG30430-PA 1..51 1..51 351 100 Plus
Mst84Dd-PA 72 CG17935-PA 7..59 4..53 170 56.4 Plus
Mst84Dc-PB 55 CG17945-PB 1..46 1..54 164 57.4 Plus
Mst84Dc-PA 55 CG17945-PA 1..46 1..54 164 57.4 Plus
Mst84Dd-PA 72 CG17935-PA 24..58 2..40 144 61.9 Plus