Clone BO17615 Report

Search the DGRC for BO17615

Clone and Library Details

Library:BO
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with open reading frames
Original Plate Number:176
Well:15
Vector:pDNR-Dual
Associated Gene/TranscriptCG17193-RA
Protein status:BO17615.pep: Imported from assembly
Sequenced Size:238

Clone Sequence Records

BO17615.3prime Sequence

236 bp (236 high quality bases) assembled on 2006-10-13

> BO17615.3prime
ATGGTCTAGAAAGCTTGCGGCGTTGATATAGTACTCCCGCTTCTTCTGGC
ACTTCTCGTACGCAATGTAGCACAGTGCGATGGTGATGAGGACCAGTATG
GTGATGCCCATTATGATGCTGACCAGTATAATCTCATCGTTGATGCTCTT
GTACGAGTGACCACTGTAATAATTGTTGTCCGAATATCCGTATTTGCCGG
CTGTCCTGCCCCCGCCGGCCATGTCGACTGATAACT

BO17615.3prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-09 17:55:44
Subject Length Description Subject Range Query Range Score Percent Strand
CG17193-PA 207 CG17193-RA 1..204 222..19 1020 100 Minus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-10 17:59:25
Subject Length Description Subject Range Query Range Score Percent Strand
CG17193-RC 3568 CG17193-RC 193..396 222..19 1020 100 Minus
CG17193-RB 3915 CG17193-RB 540..743 222..19 1020 100 Minus
CG17193-RA 3918 CG17193-RA 543..746 222..19 1020 100 Minus
Blast to na_all.dmel.RELEASE6 performed 2015-02-10 17:59:16
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 20039593..20039736 19..162 720 100 Plus
3R 32079331 3R 20049647..20049709 160..222 315 100 Plus
X 23542271 X 17422885..17422989 42..146 240 81.9 Plus
Blast to na_te.dros performed on 2015-02-10 17:59:20 has no hits.

BO17615.3prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 13:10:47 Download gff for BO17615.3prime
Subject Subject Range Query Range Percent Splice Strand
CG17193-PA 1..207 18..222 99   Minus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-20 06:46:39 Download gff for BO17615.3prime
Subject Subject Range Query Range Percent Splice Strand
CG17193-RA 539..750 11..222 98   Minus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-10 19:10:00 Download gff for BO17615.3prime
Subject Subject Range Query Range Percent Splice Strand
CG17193-RA 543..754 11..222 98   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-10 19:10:00 Download gff for BO17615.3prime
Subject Subject Range Query Range Percent Splice Strand
3R 20039585..20039737 11..167 94 -> Plus
3R 20049654..20049709 168..222 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-20 06:46:39 Download gff for BO17615.3prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 15865307..15865459 11..167 94 -> Plus
arm_3R 15875376..15875431 168..222 98   Plus

BO17615.complete Sequence

238 bp assembled on 2008-08-28

GenBank Submission: FJ634182

> BO17615.complete
GAAGTTATCAGTCGACATGGCCGGCGGGGGCAGGACAGCCGGCAAATACG
GATATTCGGACAACAATTATTACAGTGGTCACTCGTACAAGAGCATCAAC
GATGAGATTATACTGGTCAGCATCATAATGGGCATCACCATACTGGTCCT
CATCACCATCGCACTGTGCTACATTGCGTACGAGAAGTGCCAGAAGAAGC
GGGAGTACTATATCAACGCCGCAAGCTTTCTAGACCAT

BO17615.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-27 20:31:57
Subject Length Description Subject Range Query Range Score Percent Strand
CG17193-RC 207 CG17193-PC 1..204 17..220 1020 100 Plus
CG17193-RB 207 CG17193-PB 1..204 17..220 1020 100 Plus
CG17193-RA 207 CG17193-PA 1..204 17..220 1020 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 20:31:58
Subject Length Description Subject Range Query Range Score Percent Strand
CG17193-RC 3568 CG17193-RC 193..396 17..220 1020 100 Plus
CG17193-RB 3915 CG17193-RB 540..743 17..220 1020 100 Plus
CG17193-RA 3918 CG17193-RA 543..746 17..220 1020 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 20:31:54
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 20039593..20039736 220..77 720 100 Minus
3R 32079331 3R 20049647..20049709 79..17 315 100 Minus
X 23542271 X 17422885..17422989 197..93 240 81.9 Minus
Blast to na_te.dros performed on 2014-11-27 20:31:56 has no hits.

BO17615.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-11 07:50:12 Download gff for BO17615.complete
Subject Subject Range Query Range Percent Splice Strand
CG17193-RA 539..750 17..228 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 19:08:48 Download gff for BO17615.complete
Subject Subject Range Query Range Percent Splice Strand
CG17193-RA 539..742 17..222 99   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-09-04 11:05:48 Download gff for BO17615.complete
Subject Subject Range Query Range Percent Splice Strand
CG17193-RA 539..742 17..222 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 21:23:10 Download gff for BO17615.complete
Subject Subject Range Query Range Percent Splice Strand
CG17193-RA 543..746 17..222 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 21:23:10 Download gff for BO17615.complete
Subject Subject Range Query Range Percent Splice Strand
3R 20039591..20039737 72..222 96 -> Minus
3R 20049654..20049709 17..71 98   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 19:08:48 Download gff for BO17615.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3R 15865313..15865459 72..222 96 -> Minus
arm_3R 15875376..15875431 17..71 98   Minus

BO17615.pep Sequence

Translation from 16 to 238

> BO17615.pep
MAGGGRTAGKYGYSDNNYYSGHSYKSINDEIILVSIIMGITILVLITIAL
CYIAYEKCQKKREYYINAASFLDH

BO17615.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 05:28:26
Subject Length Description Subject Range Query Range Score Percent Strand
CG17193-PC 68 CG17193-PC 1..68 1..68 355 100 Plus
CG17193-PB 68 CG17193-PB 1..68 1..68 355 100 Plus
CG17193-PA 68 CG17193-PA 1..68 1..68 355 100 Plus
CG12994-PA 67 CG12994-PA 4..67 5..68 216 69.2 Plus