Clone Sequence Records
BO18278.5prime Sequence
107 bp (107 high quality bases) assembled on 2006-10-13
> BO18278.5prime
GAAGTTATCAGTCGACATGAGAGCTAAGTGGCGTAAGAAGCGTATGCGTA
GGTTGAAGCGTAAGCGCAGAAAGATGCGTGCAAGGTCCAAGGCAAGCTTT
CTAGACC
BO18278.5prime Blast Records
Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-09 19:20:44
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| CG30425-PA | 78 | RpL41-RA | 1..75 | 17..91 | 375 | 100 | Plus |
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-11 18:49:05
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| RpL41-RA | 320 | CG30425-RA | 44..118 | 17..91 | 375 | 100 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2015-02-11 18:49:01
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| 2R | 25286936 | 2R | 24903726..24903790 | 91..27 | 325 | 100 | Minus |
Blast to na_te.dros performed on 2015-02-11 18:49:03 has no hits.
BO18278.5prime Sim4 Records
Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 13:20:52 Download gff for
BO18278.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| CG30425-PA | 1..78 | 17..95 | 97 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-27 02:58:02 Download gff for
BO18278.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| RpL41-RA | 38..123 | 10..97 | 93 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-11 21:04:33 Download gff for
BO18278.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| RpL41-RA | 38..123 | 10..97 | 93 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-11 21:04:33 Download gff for
BO18278.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| 2R | 24903721..24903792 | 23..97 | 94 | | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-27 02:58:02 Download gff for
BO18278.5prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| arm_2R | 20791244..20791315 | 23..97 | 94 | | Minus |
BO18278.3prime Sequence
107 bp (107 high quality bases) assembled on 2006-10-13
> BO18278.3prime
ATGGTCTAGAAAGCTTGCCTTGGACCTTGCACGCATCTTTCTGCGCTTAC
GCTTCAACCTACGCATACGCTTCTTACGCCACTTAGCTCTCATGTCGACT
GATAACT
BO18278.3prime Blast Records
Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-09 19:20:37
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| CG30425-PA | 78 | RpL41-RA | 1..75 | 93..19 | 375 | 100 | Minus |
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-11 15:58:45
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| RpL41-RA | 320 | CG30425-RA | 44..118 | 93..19 | 375 | 100 | Minus |
Blast to na_all.dmel.RELEASE6 performed 2015-02-11 15:58:41
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| 2R | 25286936 | 2R | 24903726..24903790 | 19..83 | 325 | 100 | Plus |
Blast to na_te.dros performed on 2015-02-11 15:58:43 has no hits.
BO18278.3prime Sim4 Records
Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 13:20:52 Download gff for
BO18278.3prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| CG30425-PA | 1..78 | 15..93 | 97 | | Minus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-25 20:16:25 Download gff for
BO18278.3prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| RpL41-RA | 38..123 | 13..100 | 93 | | Minus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-11 18:44:56 Download gff for
BO18278.3prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| RpL41-RA | 38..123 | 13..100 | 93 | | Minus |
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-11 18:44:56 Download gff for
BO18278.3prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| 2R | 24903721..24903792 | 13..87 | 94 | | Plus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-25 20:16:25 Download gff for
BO18278.3prime
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| arm_2R | 20791244..20791315 | 13..87 | 94 | | Plus |
BO18278.complete Sequence
109 bp assembled on 2009-01-10
GenBank Submission: KX795769
> BO18278.complete
GAAGTTATCAGTCGACATGAGAGCTAAGTGGCGTAAGAAGCGTATGCGTA
GGTTGAAGCGTAAGCGCAGAAAGATGCGTGCAAGGTCCAAGGCAAGCTTT
CTAGACCAT
BO18278.complete Blast Records
Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-27 13:45:10
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| RpL41-RA | 78 | CG30425-PA | 1..75 | 17..91 | 375 | 100 | Plus |
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 13:45:12
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| RpL41-RA | 320 | CG30425-RA | 44..118 | 17..91 | 375 | 100 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 13:45:08
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| 2R | 25286936 | 2R | 24903726..24903790 | 91..27 | 325 | 100 | Minus |
Blast to na_te.dros performed on 2014-11-27 13:45:09 has no hits.
BO18278.complete Sim4 Records
Sim4 to dmel-all-transcript-r5.12.fasta performed 2009-01-10 14:42:37 Download gff for
BO18278.complete
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| RpL41-RA | 38..112 | 17..93 | 97 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 07:54:03 Download gff for
BO18278.complete
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| RpL41-RA | 44..118 | 17..93 | 97 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 14:25:44 Download gff for
BO18278.complete
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| RpL41-RA | 44..118 | 17..93 | 97 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 14:25:44 Download gff for
BO18278.complete
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| 2R | 24903724..24903792 | 23..93 | 94 | | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 07:54:03 Download gff for
BO18278.complete
| Subject | Subject Range | Query Range | Percent | Splice | Strand |
|---|
| arm_2R | 20791247..20791315 | 23..93 | 94 | | Minus |
BO18278.pep Sequence
Translation from 16 to 109
> BO18278.pep
MRAKWRKKRMRRLKRKRRKMRARSKASFLDH
BO18278.pep Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 01:09:42
| Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
|---|
| RpL41-PA | 25 | CG30425-PA | 1..25 | 1..25 | 127 | 100 | Plus |
