Clone Sequence Records
BO18550.3prime Sequence
209 bp (209 high quality bases) assembled on 2006-10-13
> BO18550.3prime
ATGGTCTAGAAAGCTTGCCATCTTCATAATCTTCCAAATCCTATCGTGTG
CATTTGGCAATGGTGGTCGAACCACTCCAGTTCCTGTGGGTTTGCTCCTG
CTGGTGGTGGGATTGGATGAGGATGTGGAGGGCCTGGTCCCCTTTATGCT
GGTCAGGGGCCTCGGAGCCGACTTTGCTGATGGTTTTTCGGGCATGTCGA
CTGATAACT
BO18550.3prime Blast Records
Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-11 11:23:07
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG11373-PA | 180 | CG11373-RA | 1..177 | 195..19 | 885 | 100 | Minus |
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-02 18:30:36
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG11373-RA | 359 | CG11373-RA | 43..219 | 195..19 | 885 | 100 | Minus |
Blast to na_all.dmel.RELEASE6 performed 2015-02-02 18:30:28
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
3R | 32079331 | 3R | 5960790..5960945 | 40..195 | 780 | 100 | Plus |
Blast to na_te.dros performed on 2015-02-02 18:30:32 has no hits.
BO18550.3prime Sim4 Records
Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 13:24:33 Download gff for
BO18550.3prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-PA | 1..180 | 15..195 | 98 | | Minus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-08 15:42:45 Download gff for
BO18550.3prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-RA | 43..222 | 15..195 | 98 | | Minus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-02 19:15:59 Download gff for
BO18550.3prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-RA | 43..222 | 15..195 | 98 | | Minus |
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-02 19:15:59 Download gff for
BO18550.3prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3R | 5960482..5960505 | 15..39 | 92 | <- | Plus |
3R | 5960790..5960945 | 40..195 | 100 | | Plus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-08 15:42:45 Download gff for
BO18550.3prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_3R | 1786204..1786227 | 15..39 | 92 | <- | Plus |
arm_3R | 1786512..1786667 | 40..195 | 100 | | Plus |
BO18550.5prime Sequence
209 bp (209 high quality bases) assembled on 2006-10-13
> BO18550.5prime
GAAGTTATCAGTCGACATGCCCGAAAAACCATCAGCAAAGTCGGCTCCGA
GGCCCCTGACCAGCATAAAGGGGACCAGGCCCTCCACATCCTCATCCAAT
CCCACCACCAGCAGGAGCAAACCCACAGGAACTGGAGTGGTTCGACCACC
ATTGCCAAATGCACACGATAGGATTTGGAAGATTATGAAGATGGCAAGCT
TTCTAGACC
BO18550.5prime Blast Records
Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-11 11:23:08
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG11373-PA | 180 | CG11373-RA | 1..177 | 17..193 | 885 | 100 | Plus |
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-10 17:58:56
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG11373-RA | 359 | CG11373-RA | 43..219 | 17..193 | 885 | 100 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2015-02-10 17:58:51
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
3R | 32079331 | 3R | 5960790..5960945 | 172..17 | 780 | 100 | Minus |
Blast to na_te.dros performed on 2015-02-10 17:58:53 has no hits.
BO18550.5prime Sim4 Records
Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 13:24:34 Download gff for
BO18550.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-PA | 1..180 | 17..197 | 98 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-20 14:43:52 Download gff for
BO18550.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-RA | 43..222 | 17..197 | 98 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-10 19:08:52 Download gff for
BO18550.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-RA | 43..222 | 17..197 | 98 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-10 19:08:52 Download gff for
BO18550.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3R | 5960482..5960505 | 173..197 | 92 | <- | Minus |
3R | 5960790..5960945 | 17..172 | 100 | | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-20 14:43:52 Download gff for
BO18550.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_3R | 1786204..1786227 | 173..197 | 92 | <- | Minus |
arm_3R | 1786512..1786667 | 17..172 | 100 | | Minus |
BO18550.complete Sequence
211 bp assembled on 2006-10-11
GenBank Submission: FJ634471
> BO18550.complete
GAAGTTATCAGTCGACATGCCCGAAAAACCATCAGCAAAGTCGGCTCCGA
GGCCCCTGACCAGCATAAAGGGGACCAGGCCCTCCACATCCTCATCCAAT
CCCACCACCAGCAGGAGCAAACCCACAGGAACTGGAGTGGTTCGACCACC
ATTGCCAAATGCACACGATAGGATTTGGAAGATTATGAAGATGGCAAGCT
TTCTAGACCAT
BO18550.complete Blast Records
Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 00:17:00
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG11373-RA | 180 | CG11373-PA | 1..177 | 17..193 | 885 | 100 | Plus |
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 00:17:01
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG11373-RA | 359 | CG11373-RA | 43..219 | 17..193 | 885 | 100 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 00:16:58
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
3R | 32079331 | 3R | 5960790..5960945 | 172..17 | 780 | 100 | Minus |
Blast to na_te.dros performed on 2014-11-28 00:16:59 has no hits.
BO18550.complete Sim4 Records
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 14:19:53 Download gff for
BO18550.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-RA | 1..180 | 17..197 | 98 | | Plus |
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-11 05:38:27 Download gff for
BO18550.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-RA | 41..220 | 17..197 | 98 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 19:49:07 Download gff for
BO18550.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-RA | 43..219 | 17..195 | 98 | | Plus |
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 14:19:53 Download gff for
BO18550.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-RA | 41..220 | 17..197 | 98 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 01:17:38 Download gff for
BO18550.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-RA | 43..219 | 17..195 | 98 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 01:17:38 Download gff for
BO18550.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3R | 5960483..5960505 | 173..195 | 91 | <- | Minus |
3R | 5960790..5960945 | 17..172 | 100 | | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 19:49:07 Download gff for
BO18550.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_3R | 1786205..1786227 | 173..195 | 91 | <- | Minus |
arm_3R | 1786512..1786667 | 17..172 | 100 | | Minus |
BO18550.pep Sequence
Translation from 16 to 211
> BO18550.pep
MPEKPSAKSAPRPLTSIKGTRPSTSSSNPTTSRSKPTGTGVVRPPLPNAH
DRIWKIMKMASFLDH
BO18550.pep Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 20:50:50
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG11373-PA | 59 | CG11373-PA | 1..59 | 1..59 | 311 | 100 | Plus |