Clone BO18550 Report

Search the DGRC for BO18550

Clone and Library Details

Library:BO
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with open reading frames
Original Plate Number:185
Well:50
Vector:pDNR-Dual
Associated Gene/TranscriptCG11373-RA
Protein status:BO18550.pep: validated full length
Sequenced Size:211

Clone Sequence Records

BO18550.3prime Sequence

209 bp (209 high quality bases) assembled on 2006-10-13

> BO18550.3prime
ATGGTCTAGAAAGCTTGCCATCTTCATAATCTTCCAAATCCTATCGTGTG
CATTTGGCAATGGTGGTCGAACCACTCCAGTTCCTGTGGGTTTGCTCCTG
CTGGTGGTGGGATTGGATGAGGATGTGGAGGGCCTGGTCCCCTTTATGCT
GGTCAGGGGCCTCGGAGCCGACTTTGCTGATGGTTTTTCGGGCATGTCGA
CTGATAACT

BO18550.3prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-11 11:23:07
Subject Length Description Subject Range Query Range Score Percent Strand
CG11373-PA 180 CG11373-RA 1..177 195..19 885 100 Minus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-02 18:30:36
Subject Length Description Subject Range Query Range Score Percent Strand
CG11373-RA 359 CG11373-RA 43..219 195..19 885 100 Minus
Blast to na_all.dmel.RELEASE6 performed 2015-02-02 18:30:28
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 5960790..5960945 40..195 780 100 Plus
Blast to na_te.dros performed on 2015-02-02 18:30:32 has no hits.

BO18550.3prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 13:24:33 Download gff for BO18550.3prime
Subject Subject Range Query Range Percent Splice Strand
CG11373-PA 1..180 15..195 98   Minus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-08 15:42:45 Download gff for BO18550.3prime
Subject Subject Range Query Range Percent Splice Strand
CG11373-RA 43..222 15..195 98   Minus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-02 19:15:59 Download gff for BO18550.3prime
Subject Subject Range Query Range Percent Splice Strand
CG11373-RA 43..222 15..195 98   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-02 19:15:59 Download gff for BO18550.3prime
Subject Subject Range Query Range Percent Splice Strand
3R 5960482..5960505 15..39 92 <- Plus
3R 5960790..5960945 40..195 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-08 15:42:45 Download gff for BO18550.3prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 1786204..1786227 15..39 92 <- Plus
arm_3R 1786512..1786667 40..195 100   Plus

BO18550.5prime Sequence

209 bp (209 high quality bases) assembled on 2006-10-13

> BO18550.5prime
GAAGTTATCAGTCGACATGCCCGAAAAACCATCAGCAAAGTCGGCTCCGA
GGCCCCTGACCAGCATAAAGGGGACCAGGCCCTCCACATCCTCATCCAAT
CCCACCACCAGCAGGAGCAAACCCACAGGAACTGGAGTGGTTCGACCACC
ATTGCCAAATGCACACGATAGGATTTGGAAGATTATGAAGATGGCAAGCT
TTCTAGACC

BO18550.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-11 11:23:08
Subject Length Description Subject Range Query Range Score Percent Strand
CG11373-PA 180 CG11373-RA 1..177 17..193 885 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-10 17:58:56
Subject Length Description Subject Range Query Range Score Percent Strand
CG11373-RA 359 CG11373-RA 43..219 17..193 885 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2015-02-10 17:58:51
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 5960790..5960945 172..17 780 100 Minus
Blast to na_te.dros performed on 2015-02-10 17:58:53 has no hits.

BO18550.5prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 13:24:34 Download gff for BO18550.5prime
Subject Subject Range Query Range Percent Splice Strand
CG11373-PA 1..180 17..197 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-20 14:43:52 Download gff for BO18550.5prime
Subject Subject Range Query Range Percent Splice Strand
CG11373-RA 43..222 17..197 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-10 19:08:52 Download gff for BO18550.5prime
Subject Subject Range Query Range Percent Splice Strand
CG11373-RA 43..222 17..197 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-10 19:08:52 Download gff for BO18550.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 5960482..5960505 173..197 92 <- Minus
3R 5960790..5960945 17..172 100   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-20 14:43:52 Download gff for BO18550.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 1786204..1786227 173..197 92 <- Minus
arm_3R 1786512..1786667 17..172 100   Minus

BO18550.complete Sequence

211 bp assembled on 2006-10-11

GenBank Submission: FJ634471

> BO18550.complete
GAAGTTATCAGTCGACATGCCCGAAAAACCATCAGCAAAGTCGGCTCCGA
GGCCCCTGACCAGCATAAAGGGGACCAGGCCCTCCACATCCTCATCCAAT
CCCACCACCAGCAGGAGCAAACCCACAGGAACTGGAGTGGTTCGACCACC
ATTGCCAAATGCACACGATAGGATTTGGAAGATTATGAAGATGGCAAGCT
TTCTAGACCAT

BO18550.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 00:17:00
Subject Length Description Subject Range Query Range Score Percent Strand
CG11373-RA 180 CG11373-PA 1..177 17..193 885 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 00:17:01
Subject Length Description Subject Range Query Range Score Percent Strand
CG11373-RA 359 CG11373-RA 43..219 17..193 885 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 00:16:58
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 5960790..5960945 172..17 780 100 Minus
Blast to na_te.dros performed on 2014-11-28 00:16:59 has no hits.

BO18550.complete Sim4 Records

Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 14:19:53 Download gff for BO18550.complete
Subject Subject Range Query Range Percent Splice Strand
CG11373-RA 1..180 17..197 98   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-11 05:38:27 Download gff for BO18550.complete
Subject Subject Range Query Range Percent Splice Strand
CG11373-RA 41..220 17..197 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 19:49:07 Download gff for BO18550.complete
Subject Subject Range Query Range Percent Splice Strand
CG11373-RA 43..219 17..195 98   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 14:19:53 Download gff for BO18550.complete
Subject Subject Range Query Range Percent Splice Strand
CG11373-RA 41..220 17..197 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 01:17:38 Download gff for BO18550.complete
Subject Subject Range Query Range Percent Splice Strand
CG11373-RA 43..219 17..195 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 01:17:38 Download gff for BO18550.complete
Subject Subject Range Query Range Percent Splice Strand
3R 5960483..5960505 173..195 91 <- Minus
3R 5960790..5960945 17..172 100   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 19:49:07 Download gff for BO18550.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3R 1786205..1786227 173..195 91 <- Minus
arm_3R 1786512..1786667 17..172 100   Minus

BO18550.pep Sequence

Translation from 16 to 211

> BO18550.pep
MPEKPSAKSAPRPLTSIKGTRPSTSSSNPTTSRSKPTGTGVVRPPLPNAH
DRIWKIMKMASFLDH

BO18550.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 20:50:50
Subject Length Description Subject Range Query Range Score Percent Strand
CG11373-PA 59 CG11373-PA 1..59 1..59 311 100 Plus