BO20211.complete Sequence
247 bp assembled on 2009-05-13
GenBank Submission: KX795097
> BO20211.complete
GAAGTTATCAGTCGACATGACAGTGCACGAATTCAAGGTGGAGATGACCT
GCGGCGGATGTGCCAGTGCCGTGGAGCGAGTCCTGGGCAAACTGGGCGAT
AAGGTCGAGAAAGTCAACATTAACCTGGAGGATCGGACGGTGAGCGTGAC
GTCGAACCTGTCGTCCGACGAGTTGATGGAGCAGCTGCGCAAGACCGGCA
AGAGCACCACCTACGTCGGGGTGAAGAAAGCAAGCTTTCTAGACCAT
BO20211.complete Blast Records
Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-27 08:17:16
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Atox1-RB | 270 | CG32446-PB | 1..213 | 17..229 | 1065 | 100 | Plus |
Atox1-RA | 216 | CG32446-PA | 1..213 | 17..229 | 1065 | 100 | Plus |
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 08:17:17
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Atox1-RB | 903 | CG32446-RB | 196..408 | 17..229 | 1065 | 100 | Plus |
Atox1-RA | 903 | CG32446-RA | 196..408 | 17..229 | 1065 | 100 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 08:17:14
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
3L | 28110227 | 3L | 21641973..21642104 | 98..229 | 660 | 100 | Plus |
3L | 28110227 | 3L | 21641287..21641362 | 23..98 | 380 | 100 | Plus |
Blast to na_te.dros performed on 2014-11-27 08:17:15 has no hits.
BO20211.complete Sim4 Records
Sim4 to dmel-all-transcript-r5.12.fasta performed 2009-05-13 18:36:52 Download gff for
BO20211.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG32446-RA | 149..361 | 17..231 | 99 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 07:30:12 Download gff for
BO20211.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Atox1-RA | 196..408 | 17..231 | 99 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 09:14:57 Download gff for
BO20211.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Atox1-RA | 196..408 | 17..231 | 99 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 09:14:57 Download gff for
BO20211.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3L | 21641285..21641362 | 17..98 | 95 | -> | Plus |
3L | 21641974..21642104 | 99..231 | 98 | | Plus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 07:30:12 Download gff for
BO20211.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_3L | 21634385..21634462 | 17..98 | 95 | -> | Plus |
arm_3L | 21635074..21635204 | 99..231 | 98 | | Plus |
BO20211.pep Sequence
Translation from 16 to 247
> BO20211.pep
MTVHEFKVEMTCGGCASAVERVLGKLGDKVEKVNINLEDRTVSVTSNLSS
DELMEQLRKTGKSTTYVGVKKASFLDH
BO20211.pep Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 00:53:18
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Atox1-PA | 71 | CG32446-PA | 1..71 | 1..71 | 356 | 100 | Plus |
Atox1-PB | 89 | CG32446-PB | 1..71 | 1..71 | 356 | 100 | Plus |