Clone BO20211 Report

Search the DGRC for BO20211

Clone and Library Details

Library:BO
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with open reading frames
Original Plate Number:202
Well:11
Vector:pDNR-Dual
Associated Gene/TranscriptAtox1-RA
Protein status:BO20211.pep: Imported from assembly
Sequenced Size:247

Clone Sequence Records

BO20211.complete Sequence

247 bp assembled on 2009-05-13

GenBank Submission: KX795097

> BO20211.complete
GAAGTTATCAGTCGACATGACAGTGCACGAATTCAAGGTGGAGATGACCT
GCGGCGGATGTGCCAGTGCCGTGGAGCGAGTCCTGGGCAAACTGGGCGAT
AAGGTCGAGAAAGTCAACATTAACCTGGAGGATCGGACGGTGAGCGTGAC
GTCGAACCTGTCGTCCGACGAGTTGATGGAGCAGCTGCGCAAGACCGGCA
AGAGCACCACCTACGTCGGGGTGAAGAAAGCAAGCTTTCTAGACCAT

BO20211.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-27 08:17:16
Subject Length Description Subject Range Query Range Score Percent Strand
Atox1-RB 270 CG32446-PB 1..213 17..229 1065 100 Plus
Atox1-RA 216 CG32446-PA 1..213 17..229 1065 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 08:17:17
Subject Length Description Subject Range Query Range Score Percent Strand
Atox1-RB 903 CG32446-RB 196..408 17..229 1065 100 Plus
Atox1-RA 903 CG32446-RA 196..408 17..229 1065 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 08:17:14
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 21641973..21642104 98..229 660 100 Plus
3L 28110227 3L 21641287..21641362 23..98 380 100 Plus
Blast to na_te.dros performed on 2014-11-27 08:17:15 has no hits.

BO20211.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2009-05-13 18:36:52 Download gff for BO20211.complete
Subject Subject Range Query Range Percent Splice Strand
CG32446-RA 149..361 17..231 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 07:30:12 Download gff for BO20211.complete
Subject Subject Range Query Range Percent Splice Strand
Atox1-RA 196..408 17..231 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 09:14:57 Download gff for BO20211.complete
Subject Subject Range Query Range Percent Splice Strand
Atox1-RA 196..408 17..231 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 09:14:57 Download gff for BO20211.complete
Subject Subject Range Query Range Percent Splice Strand
3L 21641285..21641362 17..98 95 -> Plus
3L 21641974..21642104 99..231 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 07:30:12 Download gff for BO20211.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3L 21634385..21634462 17..98 95 -> Plus
arm_3L 21635074..21635204 99..231 98   Plus

BO20211.pep Sequence

Translation from 16 to 247

> BO20211.pep
MTVHEFKVEMTCGGCASAVERVLGKLGDKVEKVNINLEDRTVSVTSNLSS
DELMEQLRKTGKSTTYVGVKKASFLDH

BO20211.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 00:53:18
Subject Length Description Subject Range Query Range Score Percent Strand
Atox1-PA 71 CG32446-PA 1..71 1..71 356 100 Plus
Atox1-PB 89 CG32446-PB 1..71 1..71 356 100 Plus