Clone BO25543 Report

Search the DGRC for BO25543

Clone and Library Details

Library:BO
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with open reading frames
Original Plate Number:255
Well:43
Vector:pDNR-Dual
Associated Gene/TranscriptMst84Db-RA
Protein status:BO25543.pep: Imported from assembly
Sequenced Size:256

Clone Sequence Records

BO25543.complete Sequence

256 bp assembled on 2010-06-28

GenBank Submission: KX794035

> BO25543.complete
GAAGTTATCAGTCGACATGTGTTGCGGACCCCTTGGATTCTGCGGACCCT
GTAGCCCGTGCGGCGGTCCTTGCGGACCTTGCGGACCCTGTGGTCCTTGC
GGTTCCTGCTGTAGTCCTTGTGGATCTTGCTGTGCGCCTTGCGGCCCTTG
CGGTCCTTGCGGTCCTTGCTGCGGGGGCTGTGGTCCATGCGGGCCTTGTG
GACCTTGCTGTGGACCTTGTAGGCCATATTGCGGGTGCGCAAGCTTTCTA
GACCAT

BO25543.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 08:53:03
Subject Length Description Subject Range Query Range Score Percent Strand
Mst84Db-RA 225 CG17934-PA 1..222 17..238 1110 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 08:53:04
Subject Length Description Subject Range Query Range Score Percent Strand
Mst84Db-RA 415 CG17934-RA 69..291 16..238 1115 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 08:53:01
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 7365284..7365506 238..16 1115 100 Minus
Blast to na_te.dros performed on 2014-11-28 08:53:03 has no hits.

BO25543.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-06-28 17:10:38 Download gff for BO25543.complete
Subject Subject Range Query Range Percent Splice Strand
Mst84Db-RA 70..291 17..240 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:30:45 Download gff for BO25543.complete
Subject Subject Range Query Range Percent Splice Strand
Mst84Db-RA 70..291 17..240 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 09:26:50 Download gff for BO25543.complete
Subject Subject Range Query Range Percent Splice Strand
Mst84Db-RA 70..291 17..240 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 09:26:50 Download gff for BO25543.complete
Subject Subject Range Query Range Percent Splice Strand
3R 7365281..7365505 17..240 99   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:30:45 Download gff for BO25543.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3R 3191003..3191227 17..240 99   Minus

BO25543.pep Sequence

Translation from 16 to 256

> BO25543.pep
MCCGPLGFCGPCSPCGGPCGPCGPCGPCGSCCSPCGSCCAPCGPCGPCGP
CCGGCGPCGPCGPCCGPCRPYCGCASFLDH

BO25543.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 06:07:45
Subject Length Description Subject Range Query Range Score Percent Strand
Mst84Db-PA 74 CG17934-PA 1..74 1..74 529 100 Plus
Mst98Cb-PA 265 CG18396-PA 202..265 7..68 274 64.8 Plus
Mst84Dd-PA 72 CG17935-PA 3..58 9..66 265 71.7 Plus
Mst98Ca-PA 334 CG11719-PA 157..275 2..70 245 45.4 Plus
Mst98Ca-PA 334 CG11719-PA 204..323 3..73 237 43.8 Plus
Mst84Dd-PA 72 CG17935-PA 3..58 12..73 235 67.2 Plus
Mst84Da-PA 63 CG17946-PA 15..63 14..65 231 67.3 Plus
Mst98Ca-PA 334 CG11719-PA 247..334 3..68 229 50.6 Plus
Mst84Dd-PA 72 CG17935-PA 9..70 2..65 224 61.2 Plus
Mst98Ca-PA 334 CG11719-PA 158..222 22..73 170 47.1 Plus
Mst98Cb-PA 265 CG18396-PA 158..221 22..73 160 47.1 Plus