Clone BO27286 Report

Search the DGRC for BO27286

Clone and Library Details

Library:BO
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with open reading frames
Original Plate Number:272
Well:86
Vector:pDNR-Dual
Associated Gene/TranscriptCG17931-RA
Protein status:BO27286.pep: Imported from assembly
Sequenced Size:232

Clone Sequence Records

BO27286.complete Sequence

232 bp assembled on 2012-04-24

> BO27286.complete
GAAGTTATCAGTCGACATGACACGCGGCAACCAACGAGACCTGGCCCGCC
AGAAGAACCAGAAGAAGCAGGCGGATTTGACCAAGGGAAAGCGAACCGAT
AACCTCACCGTGGAGCAAAGGAAGGCCAGGGACGCTGAGTTAATGCGGGA
GAAGCAGAAAAAAAAGGAAGAGGCCGCTGCGGCGGGCACAAGCAAAGCAA
GCTTTCTAGACCATTCGTTTGGCGCTAAAGGG

BO27286.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 05:22:36
Subject Length Description Subject Range Query Range Score Percent Strand
CG17931-RD 183 CG17931-PD 1..180 17..196 900 100 Plus
CG17931-RC 183 CG17931-PC 1..180 17..196 900 100 Plus
CG17931-RA 183 CG17931-PA 1..180 17..196 900 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 05:22:37
Subject Length Description Subject Range Query Range Score Percent Strand
CG17931-RD 1367 CG17931-RD 178..357 17..196 900 100 Plus
CG17931-RC 1081 CG17931-RC 178..357 17..196 900 100 Plus
CG17931-RA 762 CG17931-RA 178..357 17..196 900 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 05:22:34
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 16358682..16358788 130..24 535 100 Minus
3R 32079331 3R 16358545..16358614 196..127 350 100 Minus
Blast to na_te.dros performed on 2014-11-28 05:22:35 has no hits.

BO27286.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2012-04-24 17:02:31 Download gff for BO27286.complete
Subject Subject Range Query Range Percent Splice Strand
CG17931-RA 176..355 17..196 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:38:11 Download gff for BO27286.complete
Subject Subject Range Query Range Percent Splice Strand
CG17931-RA 178..357 17..196 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 06:09:49 Download gff for BO27286.complete
Subject Subject Range Query Range Percent Splice Strand
CG17931-RA 178..357 17..196 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 06:09:49 Download gff for BO27286.complete
Subject Subject Range Query Range Percent Splice Strand
3R 16358545..16358611 130..196 100 <- Minus
3R 16358683..16358792 17..129 96   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:38:11 Download gff for BO27286.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3R 12184267..12184333 130..196 100 <- Minus
arm_3R 12184405..12184514 17..129 96   Minus

BO27286.pep Sequence

Translation from 16 to 232

> BO27286.pep
MTRGNQRDLARQKNQKKQADLTKGKRTDNLTVEQRKARDAELMREKQKKK
EEAAAAGTSKASFLDHSFGAKG

BO27286.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 08:19:25
Subject Length Description Subject Range Query Range Score Percent Strand
CG17931-PD 60 CG17931-PD 1..60 1..60 296 100 Plus
CG17931-PC 60 CG17931-PC 1..60 1..60 296 100 Plus
CG17931-PA 60 CG17931-PA 1..60 1..60 296 100 Plus