BO27588.complete Sequence
394 bp assembled on 2010-08-18
GenBank Submission: KX796566
> BO27588.complete
GAAGTTATCAGTCGACATGCGCTTCCTATTCGCTCTACTTCTCAGCGTGC
TCCTGTGTCTGCTCCTGGCTCAGGAGGGCAGTAGCAGCACATCTACATCC
TCGACGGCGACCACATCCACCGACTCCTCTGCCACCACTACCACGGCTTC
ATCCGCCACCACCACTACCACCACTGCCTCCTCCGCATCCACCACGACCA
CTGCCTCCTCTTCCTCCTCCTCGGCGGAGGCCAGGAGGCGCAGACGTGCT
CGCCGTCGTCGCCTGGCTCGTGAGCGCCGTCGTCGCCAGGAGCGGAGACA
GCGCCAGGAAAAGAGGAGGCGCAGGATGGAGCAGCTGCTGGTGAGGCAGC
GTCGCCTGATCAATCAACTTCAGGGAGCAAGCTTTCTAGACCAT
BO27588.complete Blast Records
Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 02:38:53
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG32453-RB | 363 | CG32453-PB | 1..360 | 17..376 | 1800 | 100 | Plus |
CG32453-RA | 363 | CG32453-PA | 1..360 | 17..376 | 1800 | 100 | Plus |
CG14454-RB | 363 | CG14454-PB | 1..360 | 17..376 | 1785 | 99.7 | Plus |
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 02:38:55
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG32453-RB | 741 | CG32453-RB | 18..377 | 17..376 | 1800 | 100 | Plus |
CG32453-RA | 444 | CG32453-RA | 18..377 | 17..376 | 1800 | 100 | Plus |
CG14454-RB | 445 | CG14454-RB | 17..376 | 17..376 | 1785 | 99.7 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 02:38:51
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
3L | 28110227 | 3L | 22697247..22697606 | 17..376 | 1800 | 100 | Plus |
3L | 28110227 | 3L | 22692153..22692512 | 376..17 | 1785 | 99.7 | Minus |
3L | 28110227 | 3L | 22693532..22693735 | 274..71 | 665 | 90.3 | Minus |
3L | 28110227 | 3L | 22696024..22696227 | 71..274 | 665 | 90.3 | Plus |
Blast to na_te.dros performed on 2014-11-28 02:38:52 has no hits.
BO27588.complete Sim4 Records
Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-08-18 15:55:15 Download gff for
BO27588.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG32453-RA | 9..368 | 17..378 | 99 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 21:18:49 Download gff for
BO27588.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG32453-RA | 18..377 | 17..378 | 99 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 03:15:41 Download gff for
BO27588.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG32453-RA | 18..377 | 17..378 | 99 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 03:15:41 Download gff for
BO27588.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3L | 22697247..22697606 | 17..378 | 99 | | Plus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 21:18:49 Download gff for
BO27588.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_3L | 22690347..22690706 | 17..378 | 99 | | Plus |
BO27588.pep Sequence
Translation from 16 to 394
> BO27588.pep
MRFLFALLLSVLLCLLLAQEGSSSTSTSSTATTSTDSSATTTTASSATTT
TTTASSASTTTTASSSSSSAEARRRRRARRRRLARERRRRQERRQRQEKR
RRRMEQLLVRQRRLINQLQGASFLDH
BO27588.pep Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 06:13:26
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG32453-PB | 120 | CG32453-PB | 1..120 | 1..120 | 559 | 100 | Plus |
CG32453-PA | 120 | CG32453-PA | 1..120 | 1..120 | 559 | 100 | Plus |
CG14454-PB | 120 | CG14454-PB | 1..120 | 1..120 | 559 | 100 | Plus |
CG14454-PA | 120 | CG14454-PA | 1..120 | 1..120 | 559 | 100 | Plus |
CG14452-PA | 117 | CG14452-PA | 1..117 | 1..120 | 408 | 74.2 | Plus |