BO28364.complete Sequence
208 bp assembled on 2011-06-28
GenBank Submission: KX795362
> BO28364.complete
GAAGTTATCAGTCGACATGTGCGGTTATGGATGCGGTCCCTATGGCTATG
GACCTTCGGGTCCTTGCGGACCATGGTGCGGACCCTGGTGTAGTCCTTGT
GCCCTCTCGCTAGGACCCTATTCCTGCTGTGGACCCAGTGGATGCGGACC
AAGCGGCCCAGCGTGTTGGCCGTATGGCTTGTACACCTGCGCAAGCTTTC
TAGACCAT
BO28364.complete Blast Records
Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-26 15:59:45
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG31639-RB | 177 | CG31639-PB | 1..174 | 17..190 | 870 | 100 | Plus |
CG31639-RA | 177 | CG31639-PA | 1..174 | 17..190 | 870 | 100 | Plus |
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:59:46
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG31639-RB | 633 | CG31639-RB | 214..387 | 17..190 | 870 | 100 | Plus |
CG31639-RA | 487 | CG31639-RA | 132..305 | 17..190 | 870 | 100 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:59:43
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
2L | 23513712 | 2L | 6154702..6154875 | 190..17 | 870 | 100 | Minus |
Blast to na_te.dros performed on 2014-11-26 15:59:44 has no hits.
BO28364.complete Sim4 Records
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-06-28 12:03:53 Download gff for
BO28364.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG31639-RB | 161..334 | 17..192 | 98 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:49:38 Download gff for
BO28364.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG31639-RA | 148..321 | 17..192 | 98 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:08:46 Download gff for
BO28364.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG31639-RA | 132..305 | 17..192 | 98 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:08:46 Download gff for
BO28364.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2L | 6154700..6154875 | 17..192 | 98 | | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:49:38 Download gff for
BO28364.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_2L | 6154700..6154875 | 17..192 | 98 | | Minus |
BO28364.pep Sequence
Translation from 16 to 208
> BO28364.pep
MCGYGCGPYGYGPSGPCGPWCGPWCSPCALSLGPYSCCGPSGCGPSGPAC
WPYGLYTCASFLDH
BO28364.pep Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 06:47:55
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG31639-PB | 58 | CG31639-PB | 1..58 | 1..58 | 389 | 100 | Plus |
CG31639-PA | 58 | CG31639-PA | 1..58 | 1..58 | 389 | 100 | Plus |
Mst98Cb-PA | 265 | CG18396-PA | 207..257 | 2..58 | 146 | 57.6 | Plus |
Mst84Dd-PA | 72 | CG17935-PA | 2..72 | 5..61 | 144 | 46.6 | Plus |
Mst84Dc-PB | 55 | CG17945-PB | 6..47 | 2..54 | 139 | 54.7 | Plus |