Clone BO28364 Report

Search the DGRC for BO28364

Clone and Library Details

Library:BO
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with open reading frames
Original Plate Number:283
Well:64
Vector:pDNR-Dual
Associated Gene/TranscriptCG31639-RA
Protein status:BO28364.pep: Imported from assembly
Sequenced Size:208

Clone Sequence Records

BO28364.complete Sequence

208 bp assembled on 2011-06-28

GenBank Submission: KX795362

> BO28364.complete
GAAGTTATCAGTCGACATGTGCGGTTATGGATGCGGTCCCTATGGCTATG
GACCTTCGGGTCCTTGCGGACCATGGTGCGGACCCTGGTGTAGTCCTTGT
GCCCTCTCGCTAGGACCCTATTCCTGCTGTGGACCCAGTGGATGCGGACC
AAGCGGCCCAGCGTGTTGGCCGTATGGCTTGTACACCTGCGCAAGCTTTC
TAGACCAT

BO28364.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-26 15:59:45
Subject Length Description Subject Range Query Range Score Percent Strand
CG31639-RB 177 CG31639-PB 1..174 17..190 870 100 Plus
CG31639-RA 177 CG31639-PA 1..174 17..190 870 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:59:46
Subject Length Description Subject Range Query Range Score Percent Strand
CG31639-RB 633 CG31639-RB 214..387 17..190 870 100 Plus
CG31639-RA 487 CG31639-RA 132..305 17..190 870 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:59:43
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 6154702..6154875 190..17 870 100 Minus
Blast to na_te.dros performed on 2014-11-26 15:59:44 has no hits.

BO28364.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-06-28 12:03:53 Download gff for BO28364.complete
Subject Subject Range Query Range Percent Splice Strand
CG31639-RB 161..334 17..192 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:49:38 Download gff for BO28364.complete
Subject Subject Range Query Range Percent Splice Strand
CG31639-RA 148..321 17..192 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:08:46 Download gff for BO28364.complete
Subject Subject Range Query Range Percent Splice Strand
CG31639-RA 132..305 17..192 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:08:46 Download gff for BO28364.complete
Subject Subject Range Query Range Percent Splice Strand
2L 6154700..6154875 17..192 98   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:49:38 Download gff for BO28364.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2L 6154700..6154875 17..192 98   Minus

BO28364.pep Sequence

Translation from 16 to 208

> BO28364.pep
MCGYGCGPYGYGPSGPCGPWCGPWCSPCALSLGPYSCCGPSGCGPSGPAC
WPYGLYTCASFLDH

BO28364.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 06:47:55
Subject Length Description Subject Range Query Range Score Percent Strand
CG31639-PB 58 CG31639-PB 1..58 1..58 389 100 Plus
CG31639-PA 58 CG31639-PA 1..58 1..58 389 100 Plus
Mst98Cb-PA 265 CG18396-PA 207..257 2..58 146 57.6 Plus
Mst84Dd-PA 72 CG17935-PA 2..72 5..61 144 46.6 Plus
Mst84Dc-PB 55 CG17945-PB 6..47 2..54 139 54.7 Plus