BO31117.complete Sequence
193 bp assembled on 2012-03-19
GenBank Submission: KX799606
> BO31117.complete
GAAGTTATCAGTCGACATGCCACCACCACACGGAGGACCCGGAGGCCATG
GACATGGAGGACCGCATCATGGCGGACCCCCGCATCATGGAGGCCACCAT
GGACCGCCACATCACCATGGACCGCCCCATCATCACCACGGACCTCGTCC
CTGCTGCCTTTGCTGCACAATTTCAGCAAGCTTTCTAGACCAT
BO31117.complete Blast Records
Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 05:22:25
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG15126-RA | 162 | CG15126-PA | 1..159 | 17..175 | 795 | 100 | Plus |
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 05:22:26
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG15126-RA | 281 | CG15126-RA | 48..206 | 17..175 | 795 | 100 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 05:22:24
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
2R | 25286936 | 2R | 19690845..19691003 | 17..175 | 795 | 100 | Plus |
Blast to na_te.dros performed on 2014-11-28 05:22:24 has no hits.
BO31117.complete Sim4 Records
Sim4 to dmel-all-transcript-r5.32.fasta performed 2012-03-19 10:05:54 Download gff for
BO31117.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG15126-RA | 1..159 | 17..177 | 98 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:38:09 Download gff for
BO31117.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG15126-RA | 48..206 | 17..177 | 98 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 06:09:46 Download gff for
BO31117.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG15126-RA | 48..206 | 17..177 | 98 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 06:09:46 Download gff for
BO31117.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2R | 19690845..19691003 | 17..177 | 98 | | Plus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:38:09 Download gff for
BO31117.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_2R | 15578350..15578508 | 17..177 | 98 | | Plus |
BO31117.pep Sequence
Translation from 16 to 193
> BO31117.pep
MPPPHGGPGGHGHGGPHHGGPPHHGGHHGPPHHHGPPHHHHGPRPCCLCC
TISASFLDH
BO31117.pep Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 07:54:01
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG15126-PA | 53 | CG15126-PA | 1..53 | 1..53 | 366 | 100 | Plus |
CG43349-PB | 70 | CG43349-PB | 15..60 | 3..43 | 172 | 70.2 | Plus |
CG43349-PA | 70 | CG43349-PA | 15..60 | 3..43 | 172 | 70.2 | Plus |
CG43349-PB | 70 | CG43349-PB | 1..50 | 1..43 | 168 | 64.7 | Plus |
CG43349-PA | 70 | CG43349-PA | 1..50 | 1..43 | 168 | 64.7 | Plus |
CG43349-PB | 70 | CG43349-PB | 20..63 | 3..39 | 156 | 63.6 | Plus |
CG43349-PA | 70 | CG43349-PA | 20..63 | 3..39 | 156 | 63.6 | Plus |
CG43349-PB | 70 | CG43349-PB | 25..68 | 3..39 | 147 | 61.4 | Plus |
CG43349-PA | 70 | CG43349-PA | 25..68 | 3..39 | 147 | 61.4 | Plus |
CG13482-PA | 102 | CG13482-PA | 20..71 | 9..45 | 132 | 51.9 | Plus |