Clone BO31117 Report

Search the DGRC for BO31117

Clone and Library Details

Library:BO
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with open reading frames
Original Plate Number:311
Well:17
Vector:pDNR-Dual
Associated Gene/TranscriptCG15126-RA
Protein status:BO31117.pep: Imported from assembly
Sequenced Size:193

Clone Sequence Records

BO31117.complete Sequence

193 bp assembled on 2012-03-19

GenBank Submission: KX799606

> BO31117.complete
GAAGTTATCAGTCGACATGCCACCACCACACGGAGGACCCGGAGGCCATG
GACATGGAGGACCGCATCATGGCGGACCCCCGCATCATGGAGGCCACCAT
GGACCGCCACATCACCATGGACCGCCCCATCATCACCACGGACCTCGTCC
CTGCTGCCTTTGCTGCACAATTTCAGCAAGCTTTCTAGACCAT

BO31117.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 05:22:25
Subject Length Description Subject Range Query Range Score Percent Strand
CG15126-RA 162 CG15126-PA 1..159 17..175 795 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 05:22:26
Subject Length Description Subject Range Query Range Score Percent Strand
CG15126-RA 281 CG15126-RA 48..206 17..175 795 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 05:22:24
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 19690845..19691003 17..175 795 100 Plus
Blast to na_te.dros performed on 2014-11-28 05:22:24 has no hits.

BO31117.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2012-03-19 10:05:54 Download gff for BO31117.complete
Subject Subject Range Query Range Percent Splice Strand
CG15126-RA 1..159 17..177 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:38:09 Download gff for BO31117.complete
Subject Subject Range Query Range Percent Splice Strand
CG15126-RA 48..206 17..177 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 06:09:46 Download gff for BO31117.complete
Subject Subject Range Query Range Percent Splice Strand
CG15126-RA 48..206 17..177 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 06:09:46 Download gff for BO31117.complete
Subject Subject Range Query Range Percent Splice Strand
2R 19690845..19691003 17..177 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:38:09 Download gff for BO31117.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2R 15578350..15578508 17..177 98   Plus

BO31117.pep Sequence

Translation from 16 to 193

> BO31117.pep
MPPPHGGPGGHGHGGPHHGGPPHHGGHHGPPHHHGPPHHHHGPRPCCLCC
TISASFLDH

BO31117.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 07:54:01
Subject Length Description Subject Range Query Range Score Percent Strand
CG15126-PA 53 CG15126-PA 1..53 1..53 366 100 Plus
CG43349-PB 70 CG43349-PB 15..60 3..43 172 70.2 Plus
CG43349-PA 70 CG43349-PA 15..60 3..43 172 70.2 Plus
CG43349-PB 70 CG43349-PB 1..50 1..43 168 64.7 Plus
CG43349-PA 70 CG43349-PA 1..50 1..43 168 64.7 Plus
CG43349-PB 70 CG43349-PB 20..63 3..39 156 63.6 Plus
CG43349-PA 70 CG43349-PA 20..63 3..39 156 63.6 Plus
CG43349-PB 70 CG43349-PB 25..68 3..39 147 61.4 Plus
CG43349-PA 70 CG43349-PA 25..68 3..39 147 61.4 Plus
CG13482-PA 102 CG13482-PA 20..71 9..45 132 51.9 Plus