BO31504.complete Sequence
445 bp assembled on 2012-04-18
GenBank Submission: KX799383
> BO31504.complete
GAAGTTATCAGTCGACATGCGTCCTATTCTTGCGCTATCCCTGGCCGTCC
TGGCCACGCTGGTTGTCCTGTCCTCGCAGGCAACCTCAACATCGCCCACG
AGTAGCTCTTCCACTTCGCCGACGAGTAGCTCTTCCACTTCGCCCACGAG
CAGTTCCTCCACCTCGCCAACGAGCAGTTCCTCCTCATCGGACACAACGG
CCACTACCACGACCACAACTGCCGCGACCACCACCACCACAAGCACAACT
GAGGAGTCCAAGAAGAAACATCGCCGCAGGCACCGCCGCCGGAGGATCAT
CATCATCCGACGCGTTGGCGGTGGATTAAGGCGCCGCAGAGAGCGCGACG
GCGACGAGGATGGTGGCCGCGTCGTGAGGCGCATCCGTGTGCGCGAAGGA
AGATTCAGGCGTCGTGATGCCTTCTTCGCAAGCTTTCTAGACCAT
BO31504.complete Blast Records
Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 05:01:46
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG12522-RA | 414 | CG12522-PA | 1..411 | 17..427 | 2055 | 100 | Plus |
CG32071-RA | 453 | CG32071-PA | 30..174 | 16..160 | 605 | 94.5 | Plus |
CG12522-RA | 414 | CG12522-PA | 76..144 | 116..184 | 240 | 89.9 | Plus |
CG12522-RA | 414 | CG12522-PA | 100..168 | 92..160 | 240 | 89.9 | Plus |
CG32071-RA | 453 | CG32071-PA | 106..176 | 116..186 | 205 | 85.9 | Plus |
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 05:01:47
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG12522-RA | 498 | CG12522-RA | 29..439 | 17..427 | 2055 | 100 | Plus |
CG32071-RA | 453 | CG32071-RA | 30..174 | 16..160 | 605 | 94.5 | Plus |
CG12522-RA | 498 | CG12522-RA | 104..172 | 116..184 | 240 | 89.9 | Plus |
CG12522-RA | 498 | CG12522-RA | 128..196 | 92..160 | 240 | 89.9 | Plus |
CG32071-RA | 453 | CG32071-RA | 106..176 | 116..186 | 205 | 85.9 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 05:01:44
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
3L | 28110227 | 3L | 11108263..11108673 | 17..427 | 2055 | 100 | Plus |
3L | 28110227 | 3L | 11103700..11103844 | 160..16 | 605 | 94.5 | Minus |
3L | 28110227 | 3L | 11108338..11108406 | 116..184 | 240 | 89.9 | Plus |
3L | 28110227 | 3L | 11108362..11108430 | 92..160 | 240 | 89.9 | Plus |
3L | 28110227 | 3L | 11103698..11103768 | 186..116 | 205 | 85.9 | Minus |
Blast to na_te.dros performed on 2014-11-28 05:01:45 has no hits.
BO31504.complete Sim4 Records
Sim4 to dmel-all-transcript-r5.32.fasta performed 2012-04-18 21:42:31 Download gff for
BO31504.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG12522-RA | 1..411 | 17..429 | 99 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:21:34 Download gff for
BO31504.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG12522-RA | 29..439 | 17..429 | 99 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 05:42:16 Download gff for
BO31504.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG12522-RA | 29..439 | 17..429 | 99 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 05:42:16 Download gff for
BO31504.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3L | 11108263..11108673 | 17..429 | 99 | | Plus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:21:34 Download gff for
BO31504.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_3L | 11101363..11101773 | 17..429 | 99 | | Plus |
BO31504.pep Sequence
Translation from 16 to 445
> BO31504.pep
MRPILALSLAVLATLVVLSSQATSTSPTSSSSTSPTSSSSTSPTSSSSTS
PTSSSSSSDTTATTTTTTAATTTTTSTTEESKKKHRRRHRRRRIIIIRRV
GGGLRRRRERDGDEDGGRVVRRIRVREGRFRRRDAFFASFLDH
BO31504.pep Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 07:55:31
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG12522-PA | 137 | CG12522-PA | 1..137 | 1..137 | 660 | 100 | Plus |
CG32071-PA | 150 | CG32071-PA | 11..149 | 1..132 | 387 | 68.5 | Plus |
CG15741-PA | 135 | CG15741-PA | 4..129 | 7..124 | 204 | 41.3 | Plus |
CG32198-PB | 136 | CG32198-PB | 5..134 | 5..132 | 198 | 45.2 | Plus |
CG34105-PA | 157 | CG34105-PA | 1..155 | 1..133 | 192 | 39.5 | Plus |