Clone BO32788 Report

Search the DGRC for BO32788

Clone and Library Details

Library:BO
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with open reading frames
Original Plate Number:327
Well:88
Vector:pDNR-Dual
Associated Gene/TranscriptCG12853-RA
Protein status:BO32788.pep: Imported from assembly
Sequenced Size:196

Clone Sequence Records

BO32788.complete Sequence

196 bp assembled on 2012-07-12

GenBank Submission: KX799206

> BO32788.complete
GAAGTTATCAGTCGACATGCCGGCAAAAAAGGAATCAAACAAGGGTGCTA
AGAAAGGAGCTGCCGCTCCAGCTGGTGCCAAGCCGACCGCCGATCCTGTG
ACTTCCGAATCGAACAACGCAGCGGAACCAGCCGCCAAGGAAGCCAAGGG
TTCCAAGAAGGGCAAAGGCAAAAAGAAGGCAAGCTTTCTAGACCAT

BO32788.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 11:43:16
Subject Length Description Subject Range Query Range Score Percent Strand
CG12853-RA 165 CG12853-PA 1..162 17..178 810 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 11:43:17
Subject Length Description Subject Range Query Range Score Percent Strand
CG12853-RA 329 CG12853-RA 84..245 17..178 810 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 11:43:14
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 14933668..14933829 17..178 810 100 Plus
Blast to na_te.dros performed on 2014-11-28 11:43:15 has no hits.

BO32788.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2012-07-12 11:18:06 Download gff for BO32788.complete
Subject Subject Range Query Range Percent Splice Strand
CG12853-RA 84..245 17..180 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:30:43 Download gff for BO32788.complete
Subject Subject Range Query Range Percent Splice Strand
CG12853-RA 84..245 17..180 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 12:50:01 Download gff for BO32788.complete
Subject Subject Range Query Range Percent Splice Strand
CG12853-RA 84..245 17..180 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 12:50:01 Download gff for BO32788.complete
Subject Subject Range Query Range Percent Splice Strand
2R 14933668..14933829 17..180 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:30:43 Download gff for BO32788.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2R 10821173..10821334 17..180 98   Plus

BO32788.pep Sequence

Translation from 16 to 196

> BO32788.pep
MPAKKESNKGAKKGAAAPAGAKPTADPVTSESNNAAEPAAKEAKGSKKGK
GKKKASFLDH

BO32788.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 09:08:57
Subject Length Description Subject Range Query Range Score Percent Strand
CG12853-PA 54 CG12853-PA 1..54 1..54 272 100 Plus