BO32788.complete Sequence
196 bp assembled on 2012-07-12
GenBank Submission: KX799206
> BO32788.complete
GAAGTTATCAGTCGACATGCCGGCAAAAAAGGAATCAAACAAGGGTGCTA
AGAAAGGAGCTGCCGCTCCAGCTGGTGCCAAGCCGACCGCCGATCCTGTG
ACTTCCGAATCGAACAACGCAGCGGAACCAGCCGCCAAGGAAGCCAAGGG
TTCCAAGAAGGGCAAAGGCAAAAAGAAGGCAAGCTTTCTAGACCAT
BO32788.complete Blast Records
Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 11:43:16
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG12853-RA | 165 | CG12853-PA | 1..162 | 17..178 | 810 | 100 | Plus |
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 11:43:17
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG12853-RA | 329 | CG12853-RA | 84..245 | 17..178 | 810 | 100 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 11:43:14
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
2R | 25286936 | 2R | 14933668..14933829 | 17..178 | 810 | 100 | Plus |
Blast to na_te.dros performed on 2014-11-28 11:43:15 has no hits.
BO32788.complete Sim4 Records
Sim4 to dmel-all-transcript-r5.32.fasta performed 2012-07-12 11:18:06 Download gff for
BO32788.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG12853-RA | 84..245 | 17..180 | 98 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:30:43 Download gff for
BO32788.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG12853-RA | 84..245 | 17..180 | 98 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 12:50:01 Download gff for
BO32788.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG12853-RA | 84..245 | 17..180 | 98 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 12:50:01 Download gff for
BO32788.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2R | 14933668..14933829 | 17..180 | 98 | | Plus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:30:43 Download gff for
BO32788.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_2R | 10821173..10821334 | 17..180 | 98 | | Plus |
BO32788.pep Sequence
Translation from 16 to 196
> BO32788.pep
MPAKKESNKGAKKGAAAPAGAKPTADPVTSESNNAAEPAAKEAKGSKKGK
GKKKASFLDH
BO32788.pep Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 09:08:57
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG12853-PA | 54 | CG12853-PA | 1..54 | 1..54 | 272 | 100 | Plus |