Clone BO33903 Report

Search the DGRC for BO33903

Clone and Library Details

Library:BO
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with open reading frames
Original Plate Number:339
Well:3
Vector:pDNR-Dual
Associated Gene/TranscriptTango8-RA
Protein status:BO33903.pep: Imported from assembly
Sequenced Size:208

Clone Sequence Records

BO33903.complete Sequence

208 bp assembled on 2013-04-22

GenBank Submission: KX798419

> BO33903.complete
GAAGTTATCAGTCGACATGGCAATAACTGCAGCAGCAGCAGCAGCAGCGG
CGGCAAACAAGCTAAACAAGTATTGCTGTGCCGAGAAGCAGCAGCAGCAG
CAGCAGCAGCAACAGCAACAGCAGCCGCAGCAGCAACAGCAACATCAGCA
GATAAAAGGCAGACAAAAGGCACGAGATGTGAGAGACGTCGCAAGCTTTC
TAGACCAT

BO33903.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 13:28:55
Subject Length Description Subject Range Query Range Score Percent Strand
Tango8-RA 177 CG14503-PA 1..174 17..190 870 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 13:29:01
Subject Length Description Subject Range Query Range Score Percent Strand
Tango8-RA 177 CG14503-RA 1..174 17..190 870 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 13:28:47
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 18311822..18311995 17..190 870 100 Plus
Blast to na_te.dros performed on 2014-11-28 13:28:50 has no hits.

BO33903.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2013-04-22 16:05:31 Download gff for BO33903.complete
Subject Subject Range Query Range Percent Splice Strand
Tango8-RA 1..174 17..192 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:07:10 Download gff for BO33903.complete
Subject Subject Range Query Range Percent Splice Strand
Tango8-RA 1..174 17..192 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 14:28:48 Download gff for BO33903.complete
Subject Subject Range Query Range Percent Splice Strand
Tango8-RA 1..174 17..192 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 14:28:48 Download gff for BO33903.complete
Subject Subject Range Query Range Percent Splice Strand
2R 18311822..18311995 17..192 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:07:10 Download gff for BO33903.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2R 14199327..14199500 17..192 98   Plus

BO33903.pep Sequence

Translation from 16 to 208

> BO33903.pep
MAITAAAAAAAAANKLNKYCCAEKQQQQQQQQQQQQPQQQQQHQQIKGRQ
KARDVRDVASFLDH

BO33903.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 09:13:09
Subject Length Description Subject Range Query Range Score Percent Strand
Tango8-PA 58 CG14503-PA 1..58 1..58 293 100 Plus