BO34782.complete Sequence
223 bp assembled on 2013-10-29
GenBank Submission: KX798727
> BO34782.complete
GAAGTTATCAGTCGACATGTCTCGCCTTTTTATTTTAGCACTTATTCTGT
CCATCCTAGCCGACAGTGCTTTTGGTAATATTGATGAGCTTTTACGAAGC
ATTGACAGGGCACTTGGTGGAGCCTTGGGAATAAATCCTAGTCTTGCAAG
GTCTGGATTTGGTATAAGAACACCCAGTAGCGAATTTTCGATTGGATATG
GTGGCGCAAGCTTTCTAGACCAT
BO34782.complete Blast Records
Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 14:31:55
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Sfp60F-RB | 192 | CG42478-PB | 1..189 | 17..205 | 945 | 100 | Plus |
Sfp60F-RA | 249 | CG42478-PA | 58..246 | 17..205 | 945 | 100 | Plus |
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 14:31:56
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Sfp60F-RB | 321 | CG42478-RB | 51..239 | 17..205 | 945 | 100 | Plus |
Sfp60F-RA | 399 | CG42478-RA | 58..246 | 17..205 | 945 | 100 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 14:31:54
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
2R | 25286936 | 2R | 25172398..25172571 | 205..32 | 870 | 100 | Minus |
Blast to na_te.dros performed on 2014-11-28 14:31:55 has no hits.
BO34782.complete Sim4 Records
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-10-29 16:47:23 Download gff for
BO34782.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Sfp60F-RA | 58..246 | 17..207 | 98 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 15:16:17 Download gff for
BO34782.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Sfp60F-RA | 58..246 | 17..207 | 98 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 15:16:17 Download gff for
BO34782.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2R | 25172395..25172571 | 32..207 | 98 | <- | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-10-29 16:47:23 Download gff for
BO34782.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_2R | 21059918..21060094 | 32..207 | 98 | <- | Minus |
BO34782.pep Sequence
Translation from 16 to 223
> BO34782.pep
MSRLFILALILSILADSAFGNIDELLRSIDRALGGALGINPSLARSGFGI
RTPSSEFSIGYGGASFLDH
BO34782.pep Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 09:43:10
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Sfp60F-PB | 63 | CG42478-PB | 1..63 | 1..63 | 306 | 100 | Plus |
Sfp60F-PA | 82 | CG42478-PA | 20..82 | 1..63 | 306 | 100 | Plus |