Clone BO34782 Report

Search the DGRC for BO34782

Clone and Library Details

Library:BO
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with open reading frames
Original Plate Number:347
Well:82
Vector:pDNR-Dual
Associated Gene/TranscriptSfp60F-RB
Protein status:BO34782.pep: Imported from assembly
Sequenced Size:223

Clone Sequence Records

BO34782.complete Sequence

223 bp assembled on 2013-10-29

GenBank Submission: KX798727

> BO34782.complete
GAAGTTATCAGTCGACATGTCTCGCCTTTTTATTTTAGCACTTATTCTGT
CCATCCTAGCCGACAGTGCTTTTGGTAATATTGATGAGCTTTTACGAAGC
ATTGACAGGGCACTTGGTGGAGCCTTGGGAATAAATCCTAGTCTTGCAAG
GTCTGGATTTGGTATAAGAACACCCAGTAGCGAATTTTCGATTGGATATG
GTGGCGCAAGCTTTCTAGACCAT

BO34782.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 14:31:55
Subject Length Description Subject Range Query Range Score Percent Strand
Sfp60F-RB 192 CG42478-PB 1..189 17..205 945 100 Plus
Sfp60F-RA 249 CG42478-PA 58..246 17..205 945 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 14:31:56
Subject Length Description Subject Range Query Range Score Percent Strand
Sfp60F-RB 321 CG42478-RB 51..239 17..205 945 100 Plus
Sfp60F-RA 399 CG42478-RA 58..246 17..205 945 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 14:31:54
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 25172398..25172571 205..32 870 100 Minus
Blast to na_te.dros performed on 2014-11-28 14:31:55 has no hits.

BO34782.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-10-29 16:47:23 Download gff for BO34782.complete
Subject Subject Range Query Range Percent Splice Strand
Sfp60F-RA 58..246 17..207 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 15:16:17 Download gff for BO34782.complete
Subject Subject Range Query Range Percent Splice Strand
Sfp60F-RA 58..246 17..207 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 15:16:17 Download gff for BO34782.complete
Subject Subject Range Query Range Percent Splice Strand
2R 25172395..25172571 32..207 98 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-10-29 16:47:23 Download gff for BO34782.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2R 21059918..21060094 32..207 98 <- Minus

BO34782.pep Sequence

Translation from 16 to 223

> BO34782.pep
MSRLFILALILSILADSAFGNIDELLRSIDRALGGALGINPSLARSGFGI
RTPSSEFSIGYGGASFLDH

BO34782.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 09:43:10
Subject Length Description Subject Range Query Range Score Percent Strand
Sfp60F-PB 63 CG42478-PB 1..63 1..63 306 100 Plus
Sfp60F-PA 82 CG42478-PA 20..82 1..63 306 100 Plus