Clone BS11074 Report

Search the DGRC for BS11074

Clone and Library Details

Library:BS
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with native stop reading frames
Original Plate Number:110
Well:74
Vector:pDNR-Dual
Associated Gene/TranscriptMtnA-RA
Protein status:BS11074.pep: full length peptide match
Sequenced Size:16

Clone Sequence Records

BS11074.5prime Sequence

153 bp (152 high quality bases) assembled on 2006-04-19

> BS11074.5prime
GAAGTTATCAGTCGACATGCCTTGCCCATGCGGAAGCGGATGCAAATGCG
CCAGCCAGGCCACCAAGGGATCCTGCAACTGCGGATCTGACTGCAAGTGC
GGCGGCGACAAGAAATCCGCCTGCGGCTGCTCCGAGTGAAAGCTTTCTAG
ACC

BS11074.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-06 19:01:37
Subject Length Description Subject Range Query Range Score Percent Strand
CG9470-PA 123 MtnA-RA 1..123 17..139 615 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-11 16:37:31
Subject Length Description Subject Range Query Range Score Percent Strand
MtnA-RB 700 CG9470-RB 126..248 17..139 615 100 Plus
MtnA-RA 329 CG9470-RA 126..248 17..139 615 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2015-02-11 16:37:23
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 9783859..9783960 139..38 510 100 Minus
Blast to na_te.dros performed on 2015-02-11 16:37:27 has no hits.

BS11074.5prime Sim4 Records

Sim4 to dmel-all-CDS-r4.3.fasta performed 2007-01-18 10:57:57 Download gff for BS11074.5prime
Subject Subject Range Query Range Percent Splice Strand
MtnA-PA 1..123 17..139 100   Plus
Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-10 12:25:01 Download gff for BS11074.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9470-PA 1..123 17..139 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-26 16:45:30 Download gff for BS11074.5prime
Subject Subject Range Query Range Percent Splice Strand
MtnA-RA 117..254 8..147 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-11 19:19:38 Download gff for BS11074.5prime
Subject Subject Range Query Range Percent Splice Strand
MtnA-RA 117..254 8..147 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-11 19:19:38 Download gff for BS11074.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 9783853..9783959 39..147 98 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-26 16:45:30 Download gff for BS11074.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 5609575..5609681 39..147 98 <- Minus

BS11074.3prime Sequence

153 bp (152 high quality bases) assembled on 2006-04-19

> BS11074.3prime
ATGGTCTAGAAAGCTTTCACTCGGAGCAGCCGCAGGCGGATTTCTTGTCG
CCGCCGCACTTGCAGTCAGATCCGCAGTTGCAGGATCCCTTGGTGGCCTG
GCTGGCGCATTTGCATCCGCTTCCGCATGGGCAAGGCATGTCGACTGATA
ACT

BS11074.3prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-06 19:01:37
Subject Length Description Subject Range Query Range Score Percent Strand
CG9470-PA 123 MtnA-RA 1..123 139..17 615 100 Minus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-01-31 20:02:51
Subject Length Description Subject Range Query Range Score Percent Strand
MtnA-RB 700 CG9470-RB 126..248 139..17 615 100 Minus
MtnA-RA 329 CG9470-RA 126..248 139..17 615 100 Minus
Blast to na_all.dmel.RELEASE6 performed 2015-01-31 20:02:45
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 9783859..9783960 17..118 510 100 Plus
Blast to na_te.dros performed on 2015-01-31 20:02:48 has no hits.

BS11074.3prime Sim4 Records

Sim4 to dmel-all-CDS-r4.3.fasta performed 2007-01-18 10:57:56 Download gff for BS11074.3prime
Subject Subject Range Query Range Percent Splice Strand
MtnA-PA 1..123 17..139 100   Minus
Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-10 12:24:59 Download gff for BS11074.3prime
Subject Subject Range Query Range Percent Splice Strand
CG9470-PA 1..123 17..139 100   Minus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-07 11:35:30 Download gff for BS11074.3prime
Subject Subject Range Query Range Percent Splice Strand
MtnA-RA 117..254 9..148 96   Minus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-01-31 22:48:15 Download gff for BS11074.3prime
Subject Subject Range Query Range Percent Splice Strand
MtnA-RA 117..254 9..148 96   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2015-01-31 22:48:15 Download gff for BS11074.3prime
Subject Subject Range Query Range Percent Splice Strand
3R 9783853..9783959 9..117 98 <- Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-07 11:35:30 Download gff for BS11074.3prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 5609575..5609681 9..117 98 <- Plus

BS11074.complete Sequence

155 bp assembled on 2007-12-19

GenBank Submission: FJ636760

> BS11074.complete
GAAGTTATCAGTCGACATGCCTTGCCCATGCGGAAGCGGATGCAAATGCG
CCAGCCAGGCCACCAAGGGATCCTGCAACTGCGGATCTGACTGCAAGTGC
GGCGGCGACAAGAAATCCGCCTGCGGCTGCTCCGAGTGAAAGCTTTCTAG
ACCAT

BS11074.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-27 20:33:12
Subject Length Description Subject Range Query Range Score Percent Strand
MtnA-RB 123 CG9470-PB 1..123 17..139 615 100 Plus
MtnA-RA 123 CG9470-PA 1..123 17..139 615 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 20:33:13
Subject Length Description Subject Range Query Range Score Percent Strand
MtnA-RB 700 CG9470-RB 126..248 17..139 615 100 Plus
MtnA-RA 329 CG9470-RA 126..248 17..139 615 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 20:33:10
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 9783859..9783960 139..38 510 100 Minus
Blast to na_te.dros performed on 2014-11-27 20:33:10 has no hits.

BS11074.complete Sim4 Records

Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 23:13:42 Download gff for BS11074.complete
Subject Subject Range Query Range Percent Splice Strand
MtnA-RA 1..123 17..139 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2009-07-28 15:36:58 Download gff for BS11074.complete
Subject Subject Range Query Range Percent Splice Strand
MtnA-RA 127..248 17..138 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 19:11:27 Download gff for BS11074.complete
Subject Subject Range Query Range Percent Splice Strand
MtnA-RA 126..247 17..138 100   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 23:13:42 Download gff for BS11074.complete
Subject Subject Range Query Range Percent Splice Strand
MtnA-RA 118..255 8..147 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 21:23:39 Download gff for BS11074.complete
Subject Subject Range Query Range Percent Splice Strand
MtnA-RA 126..247 17..138 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 21:23:39 Download gff for BS11074.complete
Subject Subject Range Query Range Percent Splice Strand
3R 9783860..9783959 39..138 100 <- Minus
3R 9784224..9784245 17..38 100   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 19:11:27 Download gff for BS11074.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3R 5609582..5609681 39..138 100 <- Minus
arm_3R 5609946..5609967 17..38 100   Minus

BS11074.pep Sequence

Translation from 16 to 138

> BS11074.pep
MPCPCGSGCKCASQATKGSCNCGSDCKCGGDKKSACGCSE*

BS11074.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 02:38:28
Subject Length Description Subject Range Query Range Score Percent Strand
MtnA-PB 40 CG9470-PB 1..40 1..40 245 100 Plus
MtnA-PA 40 CG9470-PA 1..40 1..40 245 100 Plus