Clone BS11263 Report

Search the DGRC for BS11263

Clone and Library Details

Library:BS
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with native stop reading frames
Original Plate Number:112
Well:63
Vector:pDNR-Dual
Associated Gene/Transcriptng2-RA
Protein status:BS11263.pep: full length peptide match
Sequenced Size:16

Clone Sequence Records

BS11263.3prime Sequence

222 bp (175 high quality bases) assembled on 2006-04-18

> BS11263.3prime
ATGGTCTAGAAAGCTTTTATTCTTCCGATCTGCGGTTTCTACTGCTGCGA
CCATTGCGGCTCCTGAGACCCCTTCTCCTTGTGATTTTCCTGACCTTCTT
TGGCCTCTTGACCTTTCGCTTATAGTGAGTGACAGTCTTCTTTTTTGAGC
TCGAGGAAGGTGAGGCTGTTGTTGTGGAGGCCGAAGCGGAAGTGGCGGTG
GTGGCCGAAGCGGAAGTAGTGG

BS11263.3prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-06 19:05:25
Subject Length Description Subject Range Query Range Score Percent Strand
CG14266-PA 339 ng2-RA 134..339 222..17 980 99 Minus
CG10781-PA 324 ng1-RA 134..311 222..45 840 98.8 Minus
CG14266-PA 339 ng2-RA 110..153 222..179 145 93.1 Minus
CG10781-PA 324 ng1-RA 110..153 222..179 145 93.1 Minus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-07 01:59:08
Subject Length Description Subject Range Query Range Score Percent Strand
ng2-RA 546 CG14266-RA 171..376 222..17 1000 99 Minus
ng1-RA 523 CG10781-RA 172..349 222..45 860 98.9 Minus
Blast to na_all.dmel.RELEASE6 performed 2015-02-07 01:59:01
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 3240196..3240401 17..222 1000 99 Plus
X 23542271 X 3242583..3242760 222..45 860 98.9 Minus
X 23542271 X 3240377..3240425 174..222 185 91.8 Plus
X 23542271 X 3242559..3242607 222..174 185 91.8 Minus
Blast to na_te.dros performed 2015-02-07 01:59:06
Subject Length Description Subject Range Query Range Score Percent Strand
TART-A 13424 TART-A 13424bp 11094..11127 180..213 98 76.5 Plus

BS11263.3prime Sim4 Records

Sim4 to dmel-all-CDS-r4.3.fasta performed 2007-01-18 11:03:39 Download gff for BS11263.3prime
Subject Subject Range Query Range Percent Splice Strand
ng2-PA 134..339 17..222 99   Minus
Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-10 12:32:24 Download gff for BS11263.3prime
Subject Subject Range Query Range Percent Splice Strand
CG14266-PA 134..339 17..222 99   Minus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-11 11:23:37 Download gff for BS11263.3prime
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 171..379 14..222 98   Minus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-07 06:02:05 Download gff for BS11263.3prime
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 171..379 14..222 98   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-07 06:02:05 Download gff for BS11263.3prime
Subject Subject Range Query Range Percent Splice Strand
X 3240193..3240401 14..222 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-11 11:23:37 Download gff for BS11263.3prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 3134226..3134434 14..222 98   Plus

BS11263.5prime Sequence

369 bp (368 high quality bases) assembled on 2006-04-18

> BS11263.5prime
GAAGTTATCAGTCGACATGAAGATCACCGTGGTACTCGTACTTCTCGCCA
CCTTCCTCGGCTGTGTGATGATCCACGAGTCGGAGGCGTCCACAACCACC
ACGTCCACCTCCGCCTCGGCCACTACCACTACTTCCGCTTCGGCGACCAC
CACTACTTCCGCTTCGGCCACCACCACCACTTCCGCTTCGGCCACCACAA
CAACAGCCTCACCTTCCTCGAGCTCAAAAAAGAAGACTGTCACTCACTAT
AAGCGAAAGGTCAAGAGGCCAAAGAAGGTCAGGAAAATCACAAGGAGAAG
GGGTCTCAGGAGCCGCAATGGTCGCAGCAGTAGAAACCGCAGATCGGAAG
AATAAAAGCTTTCTAGACC

BS11263.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-06 19:05:26
Subject Length Description Subject Range Query Range Score Percent Strand
CG14266-PA 339 ng2-RA 1..339 17..355 1695 100 Plus
CG10781-PA 324 ng1-RA 1..311 17..327 1555 100 Plus
CG10788-PB 441 ng3-RB 91..137 155..201 135 91.4 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-04 05:31:19
Subject Length Description Subject Range Query Range Score Percent Strand
ng2-RA 546 CG14266-RA 37..376 16..355 1700 100 Plus
ng1-RA 523 CG10781-RA 38..349 16..327 1560 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2015-02-04 05:31:15
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 3240196..3240535 355..16 1700 100 Minus
X 23542271 X 3242449..3242760 16..327 1560 100 Plus
X 23542271 X 3242543..3242607 134..198 250 92.3 Plus
X 23542271 X 3240353..3240417 174..110 250 92.3 Minus
X 23542271 X 3240377..3240441 198..134 250 92.3 Minus
X 23542271 X 3242567..3242631 110..174 250 92.3 Plus
Blast to na_te.dros performed on 2015-02-04 05:31:17 has no hits.

BS11263.5prime Sim4 Records

Sim4 to dmel-all-CDS-r4.3.fasta performed 2007-01-18 11:03:40 Download gff for BS11263.5prime
Subject Subject Range Query Range Percent Splice Strand
ng2-PA 1..339 17..355 100   Plus
Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-10 12:32:25 Download gff for BS11263.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14266-PA 1..339 17..355 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-10 07:14:28 Download gff for BS11263.5prime
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 33..379 8..358 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-04 06:46:21 Download gff for BS11263.5prime
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 33..379 8..358 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-04 06:46:21 Download gff for BS11263.5prime
Subject Subject Range Query Range Percent Splice Strand
X 3240193..3240539 8..358 98   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-10 07:14:28 Download gff for BS11263.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 3134226..3134572 8..358 98   Minus

BS11263.complete Sequence

371 bp assembled on 2006-11-01

GenBank Submission: FJ636800

> BS11263.complete
GAAGTTATCAGTCGACATGAAGATCACCGTGGTACTCGTACTTCTCGCCA
CCTTCCTCGGCTGTGTGATGATCCACGAGTCGGAGGCGTCCACAACCACC
ACGTCCACCTCCGCCTCGGCCACTACCACTACTTCCGCTTCGGCGACCAC
CACTACTTCCGCTTCGGCCACCACCACCACTTCCGCTTCGGCCACCACAA
CAACAGCCTCACCTTCCTCGAGCTCAAAAAAGAAGACTGTCACTCACTAT
AAGCGAAAGGTCAAGAGGCCAAAGAAGGTCAGGAAAATCACAAGGAGAAG
GGGTCTCAGGAGCCGCAATGGTCGCAGCAGTAGAAACCGCAGATCGGAAG
AATAAAAGCTTTCTAGACCAT

BS11263.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-27 20:45:25
Subject Length Description Subject Range Query Range Score Percent Strand
ng2-RA 339 CG14266-PA 1..339 17..355 1695 100 Plus
ng1-RA 324 CG10781-PA 1..311 17..327 1555 100 Plus
ng2-RA 339 CG14266-PA 94..158 134..198 250 92.3 Plus
ng2-RA 339 CG14266-PA 118..182 110..174 250 92.3 Plus
ng1-RA 324 CG10781-PA 94..158 134..198 250 92.3 Plus
ng1-RA 324 CG10781-PA 118..182 110..174 250 92.3 Plus
ng3-RB 441 CG10788-PB 91..137 155..201 175 91.5 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 20:45:26
Subject Length Description Subject Range Query Range Score Percent Strand
ng2-RA 546 CG14266-RA 37..376 16..355 1700 100 Plus
ng1-RA 523 CG10781-RA 38..349 16..327 1560 100 Plus
ng2-RA 546 CG14266-RA 131..195 134..198 250 92.3 Plus
ng2-RA 546 CG14266-RA 155..219 110..174 250 92.3 Plus
ng1-RA 523 CG10781-RA 132..196 134..198 250 92.3 Plus
ng1-RA 523 CG10781-RA 156..220 110..174 250 92.3 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 20:45:22
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 3240196..3240535 355..16 1700 100 Minus
X 23542271 X 3242449..3242760 16..327 1560 100 Plus
X 23542271 X 3240377..3240441 198..134 250 92.3 Minus
X 23542271 X 3240353..3240417 174..110 250 92.3 Minus
X 23542271 X 3242543..3242607 134..198 250 92.3 Plus
X 23542271 X 3242567..3242631 110..174 250 92.3 Plus
Blast to na_te.dros performed on 2014-11-27 20:45:23 has no hits.

BS11263.complete Sim4 Records

Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 15:38:57 Download gff for BS11263.complete
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 1..339 17..355 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-11 02:16:41 Download gff for BS11263.complete
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 33..379 8..358 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 19:11:11 Download gff for BS11263.complete
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 38..368 17..347 100   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 15:38:58 Download gff for BS11263.complete
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 33..379 8..358 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 21:27:37 Download gff for BS11263.complete
Subject Subject Range Query Range Percent Splice Strand
ng2-RA 38..368 17..347 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 21:27:37 Download gff for BS11263.complete
Subject Subject Range Query Range Percent Splice Strand
X 3240204..3240534 17..347 100   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 19:11:11 Download gff for BS11263.complete
Subject Subject Range Query Range Percent Splice Strand
arm_X 3134237..3134567 17..347 100   Minus

BS11263.pep Sequence

Translation from 16 to 354

> BS11263.pep
MKITVVLVLLATFLGCVMIHESEASTTTTSTSASATTTTSASATTTTSAS
ATTTTSASATTTTASPSSSSKKKTVTHYKRKVKRPKKVRKITRRRGLRSR
NGRSSRNRRSEE*

BS11263.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 20:32:10
Subject Length Description Subject Range Query Range Score Percent Strand
ng2-PA 112 CG14266-PA 1..112 1..112 536 100 Plus
ng1-PA 107 CG10781-PA 1..105 1..105 496 99 Plus
CG33267-PB 94 CG33267-PB 1..90 1..95 257 62.1 Plus
ng3-PB 146 CG10788-PB 1..115 1..110 249 54.7 Plus
CG7377-PA 94 CG7377-PA 1..90 1..95 238 60.4 Plus