BS12408.complete Sequence
491 bp assembled on 2006-11-01
GenBank Submission: FJ637161
> BS12408.complete
GAAGTTATCAGTCGACATGTCGGCTGCTACGGAACAACAGAACAACGGCG
ATGTGGCCGTGGAGAAGGTGGCGGCAGATGATGTGTCTGCTGTCAAGGAC
GATCTCAAGGCGAAGGCGGCCGCCGAGGATAAGGCCGCTGCTGCCGATGC
CGCCGGCGACGCGGCCGACAACGGTACGTCAAAGGACGGCGAGGATGCCG
CCGATGCCGCCGCCGCTGCCCCCGCAAAGGAATCCGTGAAAGGCACCAAG
AGGCCAGCAGAAGCCAAATCCGCAGAATCAAAGAAGGCCAAGAAGGCCGC
GGCCGCCGATGGAGATTCCGATGAGGAAGAGGCTCTGGAGGAAATCATCG
AGGGCGACAGTGAAATCGAGAGCGACGAGTACGACATCCCCTACGATGGT
GAGGAGGATGACATTGAATGTGATGATGATGATGATGATAATGATGACGG
TTCCGGCTCGGACGATCAGGCGTAAAAGCTTTCTAGACCAT
BS12408.complete Blast Records
Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-27 16:49:32
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Bacc-RD | 459 | CG9894-PD | 1..459 | 17..475 | 2295 | 100 | Plus |
Bacc-RC | 459 | CG9894-PC | 1..459 | 17..475 | 2295 | 100 | Plus |
Bacc-RA | 459 | CG9894-PA | 1..459 | 17..475 | 2295 | 100 | Plus |
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 16:49:33
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Bacc-RD | 2524 | CG9894-RD | 440..898 | 17..475 | 2295 | 100 | Plus |
Bacc-RC | 2221 | CG9894-RC | 82..540 | 17..475 | 2295 | 100 | Plus |
Bacc-RA | 1010 | CG9894-RA | 183..641 | 17..475 | 2295 | 100 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 16:49:30
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
2L | 23513712 | 2L | 2753415..2753661 | 17..263 | 1235 | 100 | Plus |
2L | 23513712 | 2L | 2756008..2756174 | 263..429 | 820 | 99.4 | Plus |
2L | 23513712 | 2L | 2756244..2756294 | 425..475 | 255 | 100 | Plus |
Blast to na_te.dros performed 2014-11-27 16:49:31
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Rt1c | 5443 | Rt1c RT1C 5443bp | 1161..1230 | 218..283 | 106 | 65.7 | Plus |
BS12408.complete Sim4 Records
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 23:20:41 Download gff for
BS12408.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG9894-RA | 1..459 | 17..475 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-11 02:52:25 Download gff for
BS12408.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG9894-RA | 182..640 | 17..475 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 18:59:01 Download gff for
BS12408.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Bacc-RA | 183..639 | 17..473 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 23:20:41 Download gff for
BS12408.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG9894-RA | 182..640 | 17..475 | 100 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 17:27:52 Download gff for
BS12408.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Bacc-RA | 183..639 | 17..473 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 17:27:52 Download gff for
BS12408.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2L | 2753415..2753660 | 17..262 | 100 | -> | Plus |
2L | 2756008..2756170 | 263..425 | 100 | -> | Plus |
2L | 2756245..2756292 | 426..473 | 100 | | Plus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 18:59:01 Download gff for
BS12408.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_2L | 2753415..2753660 | 17..262 | 100 | -> | Plus |
arm_2L | 2756008..2756170 | 263..425 | 100 | -> | Plus |
arm_2L | 2756245..2756292 | 426..473 | 100 | | Plus |
BS12408.pep Sequence
Translation from 16 to 474
> BS12408.pep
MSAATEQQNNGDVAVEKVAADDVSAVKDDLKAKAAAEDKAAAADAAGDAA
DNGTSKDGEDAADAAAAAPAKESVKGTKRPAEAKSAESKKAKKAAAADGD
SDEEEALEEIIEGDSEIESDEYDIPYDGEEDDIECDDDDDDNDDGSGSDD
QA*
BS12408.pep Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 17:36:30
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Bacc-PD | 152 | CG9894-PD | 1..152 | 1..152 | 759 | 100 | Plus |
Bacc-PC | 152 | CG9894-PC | 1..152 | 1..152 | 759 | 100 | Plus |
Bacc-PA | 152 | CG9894-PA | 1..152 | 1..152 | 759 | 100 | Plus |
Bacc-PB | 152 | CG9894-PB | 1..152 | 1..152 | 759 | 100 | Plus |
CG13096-PB | 681 | CG13096-PB | 552..675 | 20..150 | 156 | 35.9 | Plus |