Clone BS12408 Report

Search the DGRC for BS12408

Clone and Library Details

Library:BS
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with native stop reading frames
Original Plate Number:124
Well:8
Vector:pDNR-Dual
Associated Gene/TranscriptBacc-RA
Protein status:BS12408.pep: full length peptide match
Sequenced Size:16

Clone Sequence Records

BS12408.complete Sequence

491 bp assembled on 2006-11-01

GenBank Submission: FJ637161

> BS12408.complete
GAAGTTATCAGTCGACATGTCGGCTGCTACGGAACAACAGAACAACGGCG
ATGTGGCCGTGGAGAAGGTGGCGGCAGATGATGTGTCTGCTGTCAAGGAC
GATCTCAAGGCGAAGGCGGCCGCCGAGGATAAGGCCGCTGCTGCCGATGC
CGCCGGCGACGCGGCCGACAACGGTACGTCAAAGGACGGCGAGGATGCCG
CCGATGCCGCCGCCGCTGCCCCCGCAAAGGAATCCGTGAAAGGCACCAAG
AGGCCAGCAGAAGCCAAATCCGCAGAATCAAAGAAGGCCAAGAAGGCCGC
GGCCGCCGATGGAGATTCCGATGAGGAAGAGGCTCTGGAGGAAATCATCG
AGGGCGACAGTGAAATCGAGAGCGACGAGTACGACATCCCCTACGATGGT
GAGGAGGATGACATTGAATGTGATGATGATGATGATGATAATGATGACGG
TTCCGGCTCGGACGATCAGGCGTAAAAGCTTTCTAGACCAT

BS12408.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-27 16:49:32
Subject Length Description Subject Range Query Range Score Percent Strand
Bacc-RD 459 CG9894-PD 1..459 17..475 2295 100 Plus
Bacc-RC 459 CG9894-PC 1..459 17..475 2295 100 Plus
Bacc-RA 459 CG9894-PA 1..459 17..475 2295 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 16:49:33
Subject Length Description Subject Range Query Range Score Percent Strand
Bacc-RD 2524 CG9894-RD 440..898 17..475 2295 100 Plus
Bacc-RC 2221 CG9894-RC 82..540 17..475 2295 100 Plus
Bacc-RA 1010 CG9894-RA 183..641 17..475 2295 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 16:49:30
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 2753415..2753661 17..263 1235 100 Plus
2L 23513712 2L 2756008..2756174 263..429 820 99.4 Plus
2L 23513712 2L 2756244..2756294 425..475 255 100 Plus
Blast to na_te.dros performed 2014-11-27 16:49:31
Subject Length Description Subject Range Query Range Score Percent Strand
Rt1c 5443 Rt1c RT1C 5443bp 1161..1230 218..283 106 65.7 Plus

BS12408.complete Sim4 Records

Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 23:20:41 Download gff for BS12408.complete
Subject Subject Range Query Range Percent Splice Strand
CG9894-RA 1..459 17..475 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-11 02:52:25 Download gff for BS12408.complete
Subject Subject Range Query Range Percent Splice Strand
CG9894-RA 182..640 17..475 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 18:59:01 Download gff for BS12408.complete
Subject Subject Range Query Range Percent Splice Strand
Bacc-RA 183..639 17..473 100   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 23:20:41 Download gff for BS12408.complete
Subject Subject Range Query Range Percent Splice Strand
CG9894-RA 182..640 17..475 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 17:27:52 Download gff for BS12408.complete
Subject Subject Range Query Range Percent Splice Strand
Bacc-RA 183..639 17..473 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 17:27:52 Download gff for BS12408.complete
Subject Subject Range Query Range Percent Splice Strand
2L 2753415..2753660 17..262 100 -> Plus
2L 2756008..2756170 263..425 100 -> Plus
2L 2756245..2756292 426..473 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 18:59:01 Download gff for BS12408.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2L 2753415..2753660 17..262 100 -> Plus
arm_2L 2756008..2756170 263..425 100 -> Plus
arm_2L 2756245..2756292 426..473 100   Plus

BS12408.pep Sequence

Translation from 16 to 474

> BS12408.pep
MSAATEQQNNGDVAVEKVAADDVSAVKDDLKAKAAAEDKAAAADAAGDAA
DNGTSKDGEDAADAAAAAPAKESVKGTKRPAEAKSAESKKAKKAAAADGD
SDEEEALEEIIEGDSEIESDEYDIPYDGEEDDIECDDDDDDNDDGSGSDD
QA*

BS12408.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 17:36:30
Subject Length Description Subject Range Query Range Score Percent Strand
Bacc-PD 152 CG9894-PD 1..152 1..152 759 100 Plus
Bacc-PC 152 CG9894-PC 1..152 1..152 759 100 Plus
Bacc-PA 152 CG9894-PA 1..152 1..152 759 100 Plus
Bacc-PB 152 CG9894-PB 1..152 1..152 759 100 Plus
CG13096-PB 681 CG13096-PB 552..675 20..150 156 35.9 Plus