Clone Sequence Records
BS14450.complete Sequence
212 bp assembled on 2010-02-09
GenBank Submission: KX802176
> BS14450.complete
GAAGTTATCAGTCGACATGCCCGAAAAACCATCAGCAAAGTCGGCTCCGA
GGCCCCTGACCAGCATAAAGGGGACCAGGCCCTCCACATCCTCATCCAAT
CCCACCACCAGCAGGAGCAAACCCACAGGAACTGGAGTGGTTCGACCACC
ATTGCCAAATGCACACGATAGGATTTGGAAGATTATGAAGATGTAAAAGC
TTTCTAGACCAT
BS14450.complete Blast Records
Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 04:23:22
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG11373-RA | 180 | CG11373-PA | 1..180 | 17..196 | 900 | 100 | Plus |
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 04:23:23
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG11373-RA | 359 | CG11373-RA | 43..222 | 17..196 | 900 | 100 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 04:23:20
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
3R | 32079331 | 3R | 5960790..5960945 | 172..17 | 780 | 100 | Minus |
Blast to na_te.dros performed on 2014-11-28 04:23:21 has no hits.
BS14450.complete Sim4 Records
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 23:16:22 Download gff for
BS14450.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-RA | 1..180 | 17..196 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-02-09 18:09:44 Download gff for
BS14450.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-RA | 41..218 | 17..194 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 21:58:15 Download gff for
BS14450.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-RA | 43..220 | 17..194 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-09-04 16:37:02 Download gff for
BS14450.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-RA | 41..218 | 17..194 | 100 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 05:27:25 Download gff for
BS14450.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-RA | 43..220 | 17..194 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 05:27:25 Download gff for
BS14450.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3R | 5960484..5960505 | 173..194 | 100 | <- | Minus |
3R | 5960790..5960945 | 17..172 | 100 | | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 21:58:15 Download gff for
BS14450.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_3R | 1786206..1786227 | 173..194 | 100 | <- | Minus |
arm_3R | 1786512..1786667 | 17..172 | 100 | | Minus |
BS14450.5prime Sequence
210 bp (210 high quality bases) assembled on 2006-10-13
> BS14450.5prime
GAAGTTATCAGTCGACATGCCCGAAAAACCATCAGCAAAGTCGGCTCCGA
GGCCCCTGACCAGCATAAAGGGGACCAGGCCCTCCACATCCTCATCCAAT
CCCACCACCAGCAGGAGCAAACCCACAGGAACTGGAGTGGTTCGACCACC
ATTGCCAAATGCACACGATAGGATTTGGAAGATTATGAAGATGTAAAAGC
TTTCTAGACC
BS14450.5prime Blast Records
Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-10 00:28:14
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG11373-PA | 180 | CG11373-RA | 1..180 | 17..196 | 900 | 100 | Plus |
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-12 16:59:11
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG11373-RA | 359 | CG11373-RA | 43..222 | 17..196 | 900 | 100 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2015-02-12 16:59:08
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
3R | 32079331 | 3R | 5960790..5960945 | 172..17 | 780 | 100 | Minus |
Blast to na_te.dros performed on 2015-02-12 16:59:09 has no hits.
BS14450.5prime Sim4 Records
Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 13:52:21 Download gff for
BS14450.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-PA | 1..180 | 17..196 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-30 17:09:43 Download gff for
BS14450.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-RA | 43..231 | 17..206 | 97 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-12 18:50:59 Download gff for
BS14450.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG11373-RA | 43..231 | 17..206 | 97 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-12 18:50:59 Download gff for
BS14450.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3R | 5960790..5960945 | 17..172 | 100 | | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-30 17:09:43 Download gff for
BS14450.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_3R | 1786512..1786667 | 17..172 | 100 | | Minus |
BS14450.pep Sequence
Translation from 16 to 195
> BS14450.pep
MPEKPSAKSAPRPLTSIKGTRPSTSSSNPTTSRSKPTGTGVVRPPLPNAH
DRIWKIMKM*
BS14450.pep Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 04:57:58
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG11373-PA | 59 | CG11373-PA | 1..59 | 1..59 | 311 | 100 | Plus |