Clone BS14450 Report

Search the DGRC for BS14450

Clone and Library Details

Library:BS
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with native stop reading frames
Original Plate Number:144
Well:50
Vector:pDNR-Dual
Associated Gene/TranscriptCG11373-RA
Protein status:BS14450.pep: full length peptide match
Sequenced Size:212

Clone Sequence Records

BS14450.complete Sequence

212 bp assembled on 2010-02-09

GenBank Submission: KX802176

> BS14450.complete
GAAGTTATCAGTCGACATGCCCGAAAAACCATCAGCAAAGTCGGCTCCGA
GGCCCCTGACCAGCATAAAGGGGACCAGGCCCTCCACATCCTCATCCAAT
CCCACCACCAGCAGGAGCAAACCCACAGGAACTGGAGTGGTTCGACCACC
ATTGCCAAATGCACACGATAGGATTTGGAAGATTATGAAGATGTAAAAGC
TTTCTAGACCAT

BS14450.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 04:23:22
Subject Length Description Subject Range Query Range Score Percent Strand
CG11373-RA 180 CG11373-PA 1..180 17..196 900 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 04:23:23
Subject Length Description Subject Range Query Range Score Percent Strand
CG11373-RA 359 CG11373-RA 43..222 17..196 900 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 04:23:20
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 5960790..5960945 172..17 780 100 Minus
Blast to na_te.dros performed on 2014-11-28 04:23:21 has no hits.

BS14450.complete Sim4 Records

Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 23:16:22 Download gff for BS14450.complete
Subject Subject Range Query Range Percent Splice Strand
CG11373-RA 1..180 17..196 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-02-09 18:09:44 Download gff for BS14450.complete
Subject Subject Range Query Range Percent Splice Strand
CG11373-RA 41..218 17..194 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 21:58:15 Download gff for BS14450.complete
Subject Subject Range Query Range Percent Splice Strand
CG11373-RA 43..220 17..194 100   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-09-04 16:37:02 Download gff for BS14450.complete
Subject Subject Range Query Range Percent Splice Strand
CG11373-RA 41..218 17..194 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 05:27:25 Download gff for BS14450.complete
Subject Subject Range Query Range Percent Splice Strand
CG11373-RA 43..220 17..194 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 05:27:25 Download gff for BS14450.complete
Subject Subject Range Query Range Percent Splice Strand
3R 5960484..5960505 173..194 100 <- Minus
3R 5960790..5960945 17..172 100   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 21:58:15 Download gff for BS14450.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3R 1786206..1786227 173..194 100 <- Minus
arm_3R 1786512..1786667 17..172 100   Minus

BS14450.5prime Sequence

210 bp (210 high quality bases) assembled on 2006-10-13

> BS14450.5prime
GAAGTTATCAGTCGACATGCCCGAAAAACCATCAGCAAAGTCGGCTCCGA
GGCCCCTGACCAGCATAAAGGGGACCAGGCCCTCCACATCCTCATCCAAT
CCCACCACCAGCAGGAGCAAACCCACAGGAACTGGAGTGGTTCGACCACC
ATTGCCAAATGCACACGATAGGATTTGGAAGATTATGAAGATGTAAAAGC
TTTCTAGACC

BS14450.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-10 00:28:14
Subject Length Description Subject Range Query Range Score Percent Strand
CG11373-PA 180 CG11373-RA 1..180 17..196 900 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-12 16:59:11
Subject Length Description Subject Range Query Range Score Percent Strand
CG11373-RA 359 CG11373-RA 43..222 17..196 900 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2015-02-12 16:59:08
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 5960790..5960945 172..17 780 100 Minus
Blast to na_te.dros performed on 2015-02-12 16:59:09 has no hits.

BS14450.5prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 13:52:21 Download gff for BS14450.5prime
Subject Subject Range Query Range Percent Splice Strand
CG11373-PA 1..180 17..196 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-30 17:09:43 Download gff for BS14450.5prime
Subject Subject Range Query Range Percent Splice Strand
CG11373-RA 43..231 17..206 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-12 18:50:59 Download gff for BS14450.5prime
Subject Subject Range Query Range Percent Splice Strand
CG11373-RA 43..231 17..206 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-12 18:50:59 Download gff for BS14450.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 5960790..5960945 17..172 100   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-30 17:09:43 Download gff for BS14450.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 1786512..1786667 17..172 100   Minus

BS14450.pep Sequence

Translation from 16 to 195

> BS14450.pep
MPEKPSAKSAPRPLTSIKGTRPSTSSSNPTTSRSKPTGTGVVRPPLPNAH
DRIWKIMKM*

BS14450.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 04:57:58
Subject Length Description Subject Range Query Range Score Percent Strand
CG11373-PA 59 CG11373-PA 1..59 1..59 311 100 Plus