Clone BS15666 Report

Search the DGRC for BS15666

Clone and Library Details

Library:BS
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with native stop reading frames
Original Plate Number:156
Well:66
Vector:pDNR-Dual
Associated Gene/TranscriptCG9284-RA
Protein status:BS15666.pep: full length peptide match
Sequenced Size:239

Clone Sequence Records

BS15666.5prime Sequence

237 bp (237 high quality bases) assembled on 2006-12-21

> BS15666.5prime
GAAGTTATCCTTTGAGGTGAATTCGAACGAGATCAGTGCATCATCGAGGA
ATACCAAAGACGCCCCAAAAACGATGTCCTCCAATGGTAGTGGTGCGGTG
GACGGCGTAAGTCCTTGTCATCTGGCCGCAACTGCGGTTGTTTCCACTGC
CAGAGGAGGCGTCAGAGAAACGAGCAGAGGACATAAGGCTATCCGTGTAT
TTTTGGATCACCACGGTGGTTAGAAGCTTTCTAGACC

BS15666.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-06 19:25:20
Subject Length Description Subject Range Query Range Score Percent Strand
CG9284-PA 207 CG9284-RA 2..207 18..223 1030 100 Plus
CG9284-PB 207 CG9284-RB 2..207 18..223 1030 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed on 2015-01-30 04:39:35 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2015-01-30 04:39:28
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 21803642..21803847 18..223 1030 100 Plus
Blast to na_te.dros performed on 2015-01-30 04:39:31 has no hits.

BS15666.5prime Sim4 Records

Sim4 to dmel-all-CDS-r4.3.fasta performed 2007-01-18 11:33:31 Download gff for BS15666.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9284-PA 2..207 18..223 100   Plus
Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-10 13:12:19 Download gff for BS15666.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9284-PB 2..207 18..223 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2015-01-30 06:47:49 Download gff for BS15666.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 21803634..21803847 11..223 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2015-01-30 06:47:49 Download gff for BS15666.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 21803634..21803847 11..223 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 05:32:44 Download gff for BS15666.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 17691139..17691352 11..223 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-05 05:32:44 Download gff for BS15666.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 17691139..17691352 11..223 98   Plus

BS15666.3prime Sequence

237 bp (237 high quality bases) assembled on 2006-12-21

> BS15666.3prime
ATGGNCTAGAAAGCTTCTACCCTCCGGGGGGATCCAAAAATACACGGATA
GCCTTATGTCCTCTGCTCGTTTCTCTGACGCCTCCTCTGGCAGTGGTAAC
AACCGCAGTTGCGGCCAGATGACAAGGACTTACGCCGTCCACCGCACCAC
TACCATTGGAGGACATCGTTTTTGGGGCGTCTTTGGTATTCCTCGATGAT
GCACTGATCTCGTTCGAATTCATGTCGACTGATAACT

BS15666.3prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-06 19:25:20
Subject Length Description Subject Range Query Range Score Percent Strand
CG9284-PA 207 CG9284-RA 1..193 223..31 940 99.4 Minus
CG9284-PB 207 CG9284-RB 1..193 223..31 940 99.4 Minus
Blast to dmel-all-transcript-r6.02.fasta performed on 2015-02-10 16:31:16 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2015-02-10 16:31:08
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 21803640..21803847 224..17 965 97.6 Minus
Blast to na_te.dros performed on 2015-02-10 16:31:12 has no hits.

BS15666.3prime Sim4 Records

Sim4 to dmel-all-CDS-r4.3.fasta performed 2007-01-18 11:33:30 Download gff for BS15666.3prime
Subject Subject Range Query Range Percent Splice Strand
CG9284-PA 1..207 17..223 97   Minus
Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-10 13:12:18 Download gff for BS15666.3prime
Subject Subject Range Query Range Percent Splice Strand
CG9284-PB 1..207 17..223 97   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-10 18:23:10 Download gff for BS15666.3prime
Subject Subject Range Query Range Percent Splice Strand
2R 21803636..21803847 17..232 95   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-10 18:23:10 Download gff for BS15666.3prime
Subject Subject Range Query Range Percent Splice Strand
2R 21803636..21803847 17..232 95   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-19 18:31:16 Download gff for BS15666.3prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 17691141..17691352 17..232 95   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-19 18:31:16 Download gff for BS15666.3prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 17691141..17691352 17..232 95   Minus

BS15666.complete Sequence

239 bp assembled on 2009-08-24

GenBank Submission: KX801325

> BS15666.complete
GAAGTTATCAGTCGACATGAATTCGAACGAGATCAGTGCATCATCGAGGA
ATACCAAAGACGCCCCAAAAACGATGTCCTCCAATGGTAGTGGTGCGGTG
GACGGCGTAAGTCCTTGTCATCTGGCCGCAACTGCGGTTGTTTCCACTGC
CAGAGGAGGCGTCAGAGAAACGAGCAGAGGACATAAGGCTATCCGTGTAT
TTTTGGATCACCACGGTGGTTAGAAGCTTTCTAGACCAT

BS15666.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed on 2014-11-28 01:31:45 has no hits.
Blast to dmel-all-transcript-r6.02.fasta performed on 2014-11-28 01:31:45 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 01:31:43
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 21803640..21803847 16..223 1040 100 Plus
Blast to na_te.dros performed on 2014-11-28 01:31:44 has no hits.

BS15666.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2009-08-26 17:02:36 Download gff for BS15666.complete
Subject Subject Range Query Range Percent Splice Strand
CG9284-RB 170..376 17..223 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 02:50:49 Download gff for BS15666.complete
Subject Subject Range Query Range Percent Splice Strand
2R 21803641..21803847 17..223 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 02:50:49 Download gff for BS15666.complete
Subject Subject Range Query Range Percent Splice Strand
2R 21803641..21803847 17..223 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 20:50:15 Download gff for BS15666.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2R 17691146..17691352 17..223 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 20:50:15 Download gff for BS15666.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2R 17691146..17691352 17..223 100   Plus

BS15666.pep Sequence

Translation from 16 to 222

> BS15666.pep
MNSNEISASSRNTKDAPKTMSSNGSGAVDGVSPCHLAATAVVSTARGGVR
ETSRGHKAIRVFLDHHGG*
Sequence BS15666.pep has no blast hits.