Clone BS16029 Report

Search the DGRC for BS16029

Clone and Library Details

Library:BS
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with native stop reading frames
Original Plate Number:160
Well:29
Vector:pDNR-Dual
Associated Gene/TranscriptCG15704-RA
Protein status:BS16029.pep: Imported from assembly
Sequenced Size:188

Clone Sequence Records

BS16029.3prime Sequence

186 bp (186 high quality bases) assembled on 2007-04-16

> BS16029.3prime
ATGGTCTAGAAAGCTTTCATTGCTCCAGCTCGTTGGTGGGTCCGTGGGTC
AGCTTGGCTCTCATGGAGCCGCAGACCATCATGCAGGCGAACAGGGACAG
CTCCAGGACACGGCACATGCAGTAGGCCACCACATCCACCAGGTGCTCCA
CCACTCCCAAGTACAGACACATGTCGACTGATAACT

BS16029.3prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-10 02:24:52
Subject Length Description Subject Range Query Range Score Percent Strand
CG15704-PA 156 CG15704-RA 1..156 172..17 780 100 Minus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-13 13:06:58
Subject Length Description Subject Range Query Range Score Percent Strand
CG15704-RA 456 CG15704-RA 179..334 172..17 780 100 Minus
Blast to na_all.dmel.RELEASE6 performed 2015-02-13 13:06:56
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 16280193..16280348 172..17 780 100 Minus
Blast to na_te.dros performed on 2015-02-13 13:06:57 has no hits.

BS16029.3prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 14:01:24 Download gff for BS16029.3prime
Subject Subject Range Query Range Percent Splice Strand
CG15704-PA 1..156 17..172 100   Minus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-09-02 18:53:20 Download gff for BS16029.3prime
Subject Subject Range Query Range Percent Splice Strand
CG15704-RA 170..334 17..180 97   Minus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-13 15:27:41 Download gff for BS16029.3prime
Subject Subject Range Query Range Percent Splice Strand
CG15704-RA 170..334 17..180 97   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-13 15:27:41 Download gff for BS16029.3prime
Subject Subject Range Query Range Percent Splice Strand
2R 16280184..16280348 17..180 97   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-09-02 18:53:20 Download gff for BS16029.3prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 12167689..12167853 17..180 97   Minus

BS16029.5prime Sequence

186 bp (186 high quality bases) assembled on 2007-04-16

> BS16029.5prime
GAAGTTATCCCTCGACATGTGTCTGTACTTGGGAGTGGTGGAGCACCTGG
TGGATGTGGTGGCCTACTGCATGTGCCGTGTCCTGGAGCTGTCCCTGTTC
GCCTGCATGATGGTCTGCGGCTCCATGAGAGCCAAGCTGACCCACGGACC
CACCAACGAGCTGGAGCAATGAAAGCTTTCTAGACC

BS16029.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-10 02:25:01
Subject Length Description Subject Range Query Range Score Percent Strand
CG15704-PA 156 CG15704-RA 1..156 17..172 780 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-12 05:04:07
Subject Length Description Subject Range Query Range Score Percent Strand
CG15704-RA 456 CG15704-RA 179..334 17..172 780 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2015-02-12 05:04:02
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 16280193..16280348 17..172 780 100 Plus
Blast to na_te.dros performed on 2015-02-12 05:04:05 has no hits.

BS16029.5prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-11 14:01:24 Download gff for BS16029.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15704-PA 1..156 17..172 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-29 07:20:01 Download gff for BS16029.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15704-RA 173..334 10..172 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-12 07:31:40 Download gff for BS16029.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15704-RA 173..334 10..172 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-12 07:31:40 Download gff for BS16029.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 16280187..16280348 10..172 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-29 07:20:01 Download gff for BS16029.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 12167692..12167853 10..172 98   Plus

BS16029.complete Sequence

188 bp assembled on 2010-02-09

GenBank Submission: KX801313

> BS16029.complete
GAAGTTATCAGTCGACATGTGTCTGTACTTGGGAGTGGTGGAGCACCTGG
TGGATGTGGTGGCCTACTGCATGTGCCGTGTCCTGGAGCTGTCCCTGTTC
GCCTGCATGATGGTCTGCGGCTCCATGAGAGCCAAGCTGACCCACGGACC
CACCAACGAGCTGGAGCAATGAAAGCTTTCTAGACCAT

BS16029.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 04:23:09
Subject Length Description Subject Range Query Range Score Percent Strand
CG15704-RA 156 CG15704-PA 1..156 17..172 780 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 04:23:10
Subject Length Description Subject Range Query Range Score Percent Strand
CG15704-RA 456 CG15704-RA 179..334 17..172 780 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 04:23:08
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 16280193..16280348 17..172 780 100 Plus
Blast to na_te.dros performed on 2014-11-28 04:23:08 has no hits.

BS16029.complete Sim4 Records

Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 23:17:53 Download gff for BS16029.complete
Subject Subject Range Query Range Percent Splice Strand
CG15704-RA 1..156 17..172 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-02-09 18:09:39 Download gff for BS16029.complete
Subject Subject Range Query Range Percent Splice Strand
CG15704-RA 180..334 17..171 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 21:58:06 Download gff for BS16029.complete
Subject Subject Range Query Range Percent Splice Strand
CG15704-RA 179..333 17..171 100   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 23:17:54 Download gff for BS16029.complete
Subject Subject Range Query Range Percent Splice Strand
CG15704-RA 171..335 9..172 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 05:27:18 Download gff for BS16029.complete
Subject Subject Range Query Range Percent Splice Strand
CG15704-RA 179..333 17..171 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 05:27:18 Download gff for BS16029.complete
Subject Subject Range Query Range Percent Splice Strand
2R 16280193..16280347 17..171 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 21:58:06 Download gff for BS16029.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2R 12167698..12167852 17..171 100   Plus

BS16029.pep Sequence

Translation from 168 to 182

> BS16029.pep
MKAF*
Sequence BS16029.pep has no blast hits.