Clone BS16715 Report

Search the DGRC for BS16715

Clone and Library Details

Library:BS
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with native stop reading frames
Original Plate Number:167
Well:15
Vector:pDNR-Dual
Associated Gene/TranscriptCG17193-RA
Protein status:BS16715.pep: full length peptide match
Sequenced Size:16

Clone Sequence Records

BS16715.3prime Sequence

237 bp (237 high quality bases) assembled on 2007-05-15

> BS16715.3prime
ATGGTCTAGAAAGCTTCTAGGCGTTGATATAGTACTCCCGCTTCTTCTGG
CACTTCTCGTACGCAATGTAGCACAGTGCGATGGTGATGAGGACCAGTAT
GGTGATGCCCATTATGATGCTGACCAGTATAATCTCATCGTTGATGCTCT
TGTACGAGTGACCACTGTAATAATTGTTGTCCGAATATCCGTATTTGCCG
GCTGTCCTGCCCCCGCCGGCCATGTCGACTGATAACT

BS16715.3prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-15 17:13:02
Subject Length Description Subject Range Query Range Score Percent Strand
CG17193-PA 207 CG17193-RA 1..207 223..17 1035 100 Minus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-13 12:04:26
Subject Length Description Subject Range Query Range Score Percent Strand
CG17193-RC 3568 CG17193-RC 193..400 223..16 1040 100 Minus
CG17193-RB 3915 CG17193-RB 540..747 223..16 1040 100 Minus
CG17193-RA 3918 CG17193-RA 543..750 223..16 1040 100 Minus
Blast to na_all.dmel.RELEASE6 performed 2015-02-13 12:04:25
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 20039589..20039736 16..163 740 100 Plus
3R 32079331 3R 20049647..20049709 161..223 315 100 Plus
X 23542271 X 17422885..17422989 43..147 240 81.9 Plus
Blast to na_te.dros performed on 2015-02-13 12:04:26 has no hits.

BS16715.3prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-15 17:13:04 Download gff for BS16715.3prime
Subject Subject Range Query Range Percent Splice Strand
CG17193-PA 1..207 17..223 100   Minus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-09-02 17:56:47 Download gff for BS16715.3prime
Subject Subject Range Query Range Percent Splice Strand
CG17193-RA 539..750 11..223 99   Minus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-13 14:23:16 Download gff for BS16715.3prime
Subject Subject Range Query Range Percent Splice Strand
CG17193-RA 543..754 11..223 99   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-13 14:23:16 Download gff for BS16715.3prime
Subject Subject Range Query Range Percent Splice Strand
3R 20039585..20039737 11..168 96 -> Plus
3R 20049654..20049709 169..223 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-09-02 17:56:47 Download gff for BS16715.3prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 15865307..15865459 11..168 96 -> Plus
arm_3R 15875376..15875431 169..223 98   Plus

BS16715.5prime Sequence

237 bp (237 high quality bases) assembled on 2007-05-15

> BS16715.5prime
GAAGTTATCAGTCGACATGGCCGGCGGGGGCAGGACAGCCGGCAAATACG
GATATTCGGACAACAATTATTACAGTGGTCACTCGTACAAGAGCATCAAC
GATGAGATTATACTGGTCAGCATCATAATGGGCATCACCATACTGGTCCT
CATCACCATCGCACTGTGCTACATTGCGTACGAGAAGTGCCAGAAGAAGC
GGGAGTACTATATCAACGCCTAGAAGCTTTCTAGACC

BS16715.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-15 17:08:15
Subject Length Description Subject Range Query Range Score Percent Strand
CG17193-PA 207 CG17193-RA 1..207 17..223 1035 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-10 15:58:55
Subject Length Description Subject Range Query Range Score Percent Strand
CG17193-RC 3568 CG17193-RC 193..400 17..224 1040 100 Plus
CG17193-RB 3915 CG17193-RB 540..747 17..224 1040 100 Plus
CG17193-RA 3918 CG17193-RA 543..750 17..224 1040 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2015-02-10 15:58:47
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 20039589..20039736 224..77 740 100 Minus
3R 32079331 3R 20049647..20049709 79..17 315 100 Minus
X 23542271 X 17422885..17422989 197..93 240 81.9 Minus
Blast to na_te.dros performed on 2015-02-10 15:58:51 has no hits.

BS16715.5prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-15 17:08:17 Download gff for BS16715.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17193-PA 1..207 17..223 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-20 02:35:22 Download gff for BS16715.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17193-RA 539..750 17..229 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-10 18:26:33 Download gff for BS16715.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17193-RA 543..754 17..229 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-10 18:26:33 Download gff for BS16715.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 20039585..20039737 72..229 96 -> Minus
3R 20049654..20049709 17..71 98   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-20 02:35:22 Download gff for BS16715.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 15865307..15865459 72..229 96 -> Minus
arm_3R 15875376..15875431 17..71 98   Minus

BS16715.complete Sequence

239 bp assembled on 2007-05-07

GenBank Submission: FJ638183

> BS16715.complete
GAAGTTATCAGTCGACATGGCCGGCGGGGGCAGGACAGCCGGCAAATACG
GATATTCGGACAACAATTATTACAGTGGTCACTCGTACAAGAGCATCAAC
GATGAGATTATACTGGTCAGCATCATAATGGGCATCACCATACTGGTCCT
CATCACCATCGCACTGTGCTACATTGCGTACGAGAAGTGCCAGAAGAAGC
GGGAGTACTATATCAACGCCTAGAAGCTTTCTAGACCAT

BS16715.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 08:09:32
Subject Length Description Subject Range Query Range Score Percent Strand
CG17193-RC 207 CG17193-PC 1..207 17..223 1035 100 Plus
CG17193-RB 207 CG17193-PB 1..207 17..223 1035 100 Plus
CG17193-RA 207 CG17193-PA 1..207 17..223 1035 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 08:09:33
Subject Length Description Subject Range Query Range Score Percent Strand
CG17193-RC 3568 CG17193-RC 193..400 17..224 1040 100 Plus
CG17193-RB 3915 CG17193-RB 540..747 17..224 1040 100 Plus
CG17193-RA 3918 CG17193-RA 543..750 17..224 1040 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 08:09:29
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 20039589..20039736 224..77 740 100 Minus
3R 32079331 3R 20049647..20049709 79..17 315 100 Minus
X 23542271 X 17422885..17422989 197..93 240 81.9 Minus
Blast to na_te.dros performed on 2014-11-28 08:09:30 has no hits.

BS16715.complete Sim4 Records

Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 23:30:09 Download gff for BS16715.complete
Subject Subject Range Query Range Percent Splice Strand
CG17193-RA 1..207 17..223 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-07-28 16:38:56 Download gff for BS16715.complete
Subject Subject Range Query Range Percent Splice Strand
CG17193-RA 539..745 17..223 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:13:00 Download gff for BS16715.complete
Subject Subject Range Query Range Percent Splice Strand
CG17193-RA 539..745 17..223 100   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 23:30:09 Download gff for BS16715.complete
Subject Subject Range Query Range Percent Splice Strand
CG17193-RA 539..750 17..229 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 09:12:09 Download gff for BS16715.complete
Subject Subject Range Query Range Percent Splice Strand
CG17193-RA 543..749 17..223 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 09:12:09 Download gff for BS16715.complete
Subject Subject Range Query Range Percent Splice Strand
3R 20039590..20039737 72..223 97 -> Minus
3R 20049654..20049709 17..71 98   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:13:00 Download gff for BS16715.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3R 15875376..15875431 17..71 98   Minus
arm_3R 15865312..15865459 72..223 97 -> Minus

BS16715.pep Sequence

Translation from 16 to 222

> BS16715.pep
MAGGGRTAGKYGYSDNNYYSGHSYKSINDEIILVSIIMGITILVLITIAL
CYIAYEKCQKKREYYINA*

BS16715.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 17:26:50
Subject Length Description Subject Range Query Range Score Percent Strand
CG17193-PC 68 CG17193-PC 1..68 1..68 355 100 Plus
CG17193-PB 68 CG17193-PB 1..68 1..68 355 100 Plus
CG17193-PA 68 CG17193-PA 1..68 1..68 355 100 Plus
CG12994-PA 67 CG12994-PA 4..67 5..68 216 69.2 Plus