Clone BS16804 Report

Search the DGRC for BS16804

Clone and Library Details

Library:BS
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with native stop reading frames
Original Plate Number:168
Well:4
Vector:pDNR-Dual
Associated Gene/Transcriptcype-RA
Protein status:BS16804.pep: full length peptide match
Sequenced Size:266

Clone Sequence Records

BS16804.complete Sequence

266 bp assembled on 2010-02-09

GenBank Submission: KX801191

> BS16804.complete
GAAGTTATCAGTCGACATGGCCAACACTCCAGCCACCTCCTCTGCCGGAC
CCGTGCTCCGTGGCCTCCACAATGCCACCATCAAGCGCAACCTGGCCGTT
TCCCTGGGCCTGACCGCCGTGGTGACCATCGCCTACAAAATTCTGGTCAA
CGATCCCAAGAAGGCCGCCTACGCCGACTTCTACTCGAAGTACGATGCCA
ACAAGTCCTTCGAGCGCATGAAGGCCGCCGGTCGTTTCCAGTCCTGCTAG
AAGCTTTCTAGACCAT

BS16804.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 04:35:13
Subject Length Description Subject Range Query Range Score Percent Strand
cype-RC 234 CG14028-PC 1..234 17..250 1170 100 Plus
cype-RB 234 CG14028-PB 1..234 17..250 1170 100 Plus
cype-RA 234 CG14028-PA 1..234 17..250 1170 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 04:35:14
Subject Length Description Subject Range Query Range Score Percent Strand
cype-RC 460 CG14028-RC 60..298 12..250 1195 100 Plus
cype-RA 396 CG14028-RA 60..298 12..250 1195 100 Plus
cype-RB 398 CG14028-RB 63..300 13..250 1190 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 04:35:11
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 5327503..5327677 13..187 875 100 Plus
2L 23513712 2L 5327744..5327807 187..250 320 100 Plus
Blast to na_te.dros performed on 2014-11-28 04:35:12 has no hits.

BS16804.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-02-09 18:12:22 Download gff for BS16804.complete
Subject Subject Range Query Range Percent Splice Strand
cype-RA 51..284 17..250 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:02:10 Download gff for BS16804.complete
Subject Subject Range Query Range Percent Splice Strand
cype-RA 65..298 17..250 100   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-09-23 18:14:27 Download gff for BS16804.complete
Subject Subject Range Query Range Percent Splice Strand
cype-RA 51..284 17..250 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 05:32:13 Download gff for BS16804.complete
Subject Subject Range Query Range Percent Splice Strand
cype-RA 65..298 17..250 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 05:32:13 Download gff for BS16804.complete
Subject Subject Range Query Range Percent Splice Strand
2L 5327507..5327676 17..186 100 -> Plus
2L 5327744..5327807 187..250 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:02:10 Download gff for BS16804.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2L 5327507..5327676 17..186 100 -> Plus
arm_2L 5327744..5327807 187..250 100   Plus

BS16804.3prime Sequence

264 bp (264 high quality bases) assembled on 2007-05-15

> BS16804.3prime
ATGGTCTAGAAAGCTTCTAGCAGGACTGGAAACGACCGGCGGCCTTCATG
CGCTCGAAGGACTTGTTGGCATCGTACTTCGAGTAGAAGTCGGCGTAGGC
GGCCTTCTTGGGATCGTTGACCAGAATTTTGTAGGCGATGGTCACCACGG
CGGTCAGGCCCAGGGAAACGGCCAGGTTGCGCTTGATGGTGGCATTGTGG
AGGCCACGGAGCACGGGTCCGGCAGAGGAGGTGGCTGGAGTGTTGGCCAT
GTCGACTGATAACT

BS16804.3prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-15 17:26:40
Subject Length Description Subject Range Query Range Score Percent Strand
CG14028-PA 234 cype-RA 1..234 250..17 1170 100 Minus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-04 21:12:37
Subject Length Description Subject Range Query Range Score Percent Strand
cype-RC 460 CG14028-RC 60..298 255..17 1195 100 Minus
cype-RA 396 CG14028-RA 60..298 255..17 1195 100 Minus
cype-RB 398 CG14028-RB 63..300 254..17 1190 100 Minus
Blast to na_all.dmel.RELEASE6 performed 2015-02-04 21:12:31
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 5327503..5327677 254..80 875 100 Minus
2L 23513712 2L 5327744..5327807 80..17 320 100 Minus
Blast to na_te.dros performed on 2015-02-04 21:12:35 has no hits.

BS16804.3prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-15 17:26:42 Download gff for BS16804.3prime
Subject Subject Range Query Range Percent Splice Strand
CG14028-PA 1..234 17..250 100   Minus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-10 21:30:26 Download gff for BS16804.3prime
Subject Subject Range Query Range Percent Splice Strand
cype-RA 60..301 12..255 99   Minus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-04 21:55:51 Download gff for BS16804.3prime
Subject Subject Range Query Range Percent Splice Strand
cype-RA 60..301 12..255 99   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-04 21:55:51 Download gff for BS16804.3prime
Subject Subject Range Query Range Percent Splice Strand
2L 5327494..5327676 81..264 97 -> Minus
2L 5327744..5327810 12..80 97   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-10 21:30:26 Download gff for BS16804.3prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 5327494..5327676 81..264 97 -> Minus
arm_2L 5327744..5327810 12..80 97   Minus

BS16804.5prime Sequence

264 bp (264 high quality bases) assembled on 2007-05-15

> BS16804.5prime
GAAGTTATCAGTCGACATGGCCAACACTCCAGCCACCTCCTCTGCCGGAC
CCGTGCTCCGTGGCCTCCACAATGCCACCATCAAGCGCAACCTGGCCGTT
TCCCTGGGCCTGACCGCCGTGGTGACCATCGCCTACAAAATTCTGGTCAA
CGATCCCAAGAAGGCCGCCTACGCCGACTTCTACTCGAAGTACGATGCCA
ACAAGTCCTTCGAGCGCATGAAGGCCGCCGGTCGTTTCCAGTCCTGCTAG
AAGCTTTCTAGACC

BS16804.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-15 17:20:48
Subject Length Description Subject Range Query Range Score Percent Strand
CG14028-PA 234 cype-RA 1..234 17..250 1170 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-04 21:07:17
Subject Length Description Subject Range Query Range Score Percent Strand
cype-RC 460 CG14028-RC 60..298 12..250 1195 100 Plus
cype-RA 396 CG14028-RA 60..298 12..250 1195 100 Plus
cype-RB 398 CG14028-RB 63..300 13..250 1190 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2015-02-04 21:07:14
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 5327503..5327677 13..187 875 100 Plus
2L 23513712 2L 5327744..5327807 187..250 320 100 Plus
Blast to na_te.dros performed on 2015-02-04 21:07:16 has no hits.

BS16804.5prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-15 17:20:50 Download gff for BS16804.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14028-PA 1..234 17..250 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-10 21:29:24 Download gff for BS16804.5prime
Subject Subject Range Query Range Percent Splice Strand
cype-RA 60..301 12..255 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-04 21:54:57 Download gff for BS16804.5prime
Subject Subject Range Query Range Percent Splice Strand
cype-RA 60..301 12..255 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-04 21:54:57 Download gff for BS16804.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 5327496..5327676 5..186 98 -> Plus
2L 5327744..5327810 187..255 97   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-10 21:29:24 Download gff for BS16804.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 5327496..5327676 5..186 98 -> Plus
arm_2L 5327744..5327810 187..255 97   Plus

BS16804.pep Sequence

Translation from 16 to 249

> BS16804.pep
MANTPATSSAGPVLRGLHNATIKRNLAVSLGLTAVVTIAYKILVNDPKKA
AYADFYSKYDANKSFERMKAAGRFQSC*

BS16804.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 05:58:14
Subject Length Description Subject Range Query Range Score Percent Strand
cype-PC 77 CG14028-PC 1..77 1..77 388 100 Plus
cype-PB 77 CG14028-PB 1..77 1..77 388 100 Plus
cype-PA 77 CG14028-PA 1..77 1..77 388 100 Plus