Clone Sequence Records
BS16804.complete Sequence
266 bp assembled on 2010-02-09
GenBank Submission: KX801191
> BS16804.complete
GAAGTTATCAGTCGACATGGCCAACACTCCAGCCACCTCCTCTGCCGGAC
CCGTGCTCCGTGGCCTCCACAATGCCACCATCAAGCGCAACCTGGCCGTT
TCCCTGGGCCTGACCGCCGTGGTGACCATCGCCTACAAAATTCTGGTCAA
CGATCCCAAGAAGGCCGCCTACGCCGACTTCTACTCGAAGTACGATGCCA
ACAAGTCCTTCGAGCGCATGAAGGCCGCCGGTCGTTTCCAGTCCTGCTAG
AAGCTTTCTAGACCAT
BS16804.complete Blast Records
Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 04:35:13
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
cype-RC | 234 | CG14028-PC | 1..234 | 17..250 | 1170 | 100 | Plus |
cype-RB | 234 | CG14028-PB | 1..234 | 17..250 | 1170 | 100 | Plus |
cype-RA | 234 | CG14028-PA | 1..234 | 17..250 | 1170 | 100 | Plus |
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 04:35:14
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
cype-RC | 460 | CG14028-RC | 60..298 | 12..250 | 1195 | 100 | Plus |
cype-RA | 396 | CG14028-RA | 60..298 | 12..250 | 1195 | 100 | Plus |
cype-RB | 398 | CG14028-RB | 63..300 | 13..250 | 1190 | 100 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 04:35:11
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
2L | 23513712 | 2L | 5327503..5327677 | 13..187 | 875 | 100 | Plus |
2L | 23513712 | 2L | 5327744..5327807 | 187..250 | 320 | 100 | Plus |
Blast to na_te.dros performed on 2014-11-28 04:35:12 has no hits.
BS16804.complete Sim4 Records
Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-02-09 18:12:22 Download gff for
BS16804.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
cype-RA | 51..284 | 17..250 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:02:10 Download gff for
BS16804.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
cype-RA | 65..298 | 17..250 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-09-23 18:14:27 Download gff for
BS16804.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
cype-RA | 51..284 | 17..250 | 100 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 05:32:13 Download gff for
BS16804.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
cype-RA | 65..298 | 17..250 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 05:32:13 Download gff for
BS16804.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2L | 5327507..5327676 | 17..186 | 100 | -> | Plus |
2L | 5327744..5327807 | 187..250 | 100 | | Plus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:02:10 Download gff for
BS16804.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_2L | 5327507..5327676 | 17..186 | 100 | -> | Plus |
arm_2L | 5327744..5327807 | 187..250 | 100 | | Plus |
BS16804.3prime Sequence
264 bp (264 high quality bases) assembled on 2007-05-15
> BS16804.3prime
ATGGTCTAGAAAGCTTCTAGCAGGACTGGAAACGACCGGCGGCCTTCATG
CGCTCGAAGGACTTGTTGGCATCGTACTTCGAGTAGAAGTCGGCGTAGGC
GGCCTTCTTGGGATCGTTGACCAGAATTTTGTAGGCGATGGTCACCACGG
CGGTCAGGCCCAGGGAAACGGCCAGGTTGCGCTTGATGGTGGCATTGTGG
AGGCCACGGAGCACGGGTCCGGCAGAGGAGGTGGCTGGAGTGTTGGCCAT
GTCGACTGATAACT
BS16804.3prime Blast Records
Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-15 17:26:40
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG14028-PA | 234 | cype-RA | 1..234 | 250..17 | 1170 | 100 | Minus |
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-04 21:12:37
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
cype-RC | 460 | CG14028-RC | 60..298 | 255..17 | 1195 | 100 | Minus |
cype-RA | 396 | CG14028-RA | 60..298 | 255..17 | 1195 | 100 | Minus |
cype-RB | 398 | CG14028-RB | 63..300 | 254..17 | 1190 | 100 | Minus |
Blast to na_all.dmel.RELEASE6 performed 2015-02-04 21:12:31
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
2L | 23513712 | 2L | 5327503..5327677 | 254..80 | 875 | 100 | Minus |
2L | 23513712 | 2L | 5327744..5327807 | 80..17 | 320 | 100 | Minus |
Blast to na_te.dros performed on 2015-02-04 21:12:35 has no hits.
BS16804.3prime Sim4 Records
Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-15 17:26:42 Download gff for
BS16804.3prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG14028-PA | 1..234 | 17..250 | 100 | | Minus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-10 21:30:26 Download gff for
BS16804.3prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
cype-RA | 60..301 | 12..255 | 99 | | Minus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-04 21:55:51 Download gff for
BS16804.3prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
cype-RA | 60..301 | 12..255 | 99 | | Minus |
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-04 21:55:51 Download gff for
BS16804.3prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2L | 5327494..5327676 | 81..264 | 97 | -> | Minus |
2L | 5327744..5327810 | 12..80 | 97 | | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-10 21:30:26 Download gff for
BS16804.3prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_2L | 5327494..5327676 | 81..264 | 97 | -> | Minus |
arm_2L | 5327744..5327810 | 12..80 | 97 | | Minus |
BS16804.5prime Sequence
264 bp (264 high quality bases) assembled on 2007-05-15
> BS16804.5prime
GAAGTTATCAGTCGACATGGCCAACACTCCAGCCACCTCCTCTGCCGGAC
CCGTGCTCCGTGGCCTCCACAATGCCACCATCAAGCGCAACCTGGCCGTT
TCCCTGGGCCTGACCGCCGTGGTGACCATCGCCTACAAAATTCTGGTCAA
CGATCCCAAGAAGGCCGCCTACGCCGACTTCTACTCGAAGTACGATGCCA
ACAAGTCCTTCGAGCGCATGAAGGCCGCCGGTCGTTTCCAGTCCTGCTAG
AAGCTTTCTAGACC
BS16804.5prime Blast Records
Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-15 17:20:48
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG14028-PA | 234 | cype-RA | 1..234 | 17..250 | 1170 | 100 | Plus |
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-04 21:07:17
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
cype-RC | 460 | CG14028-RC | 60..298 | 12..250 | 1195 | 100 | Plus |
cype-RA | 396 | CG14028-RA | 60..298 | 12..250 | 1195 | 100 | Plus |
cype-RB | 398 | CG14028-RB | 63..300 | 13..250 | 1190 | 100 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2015-02-04 21:07:14
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
2L | 23513712 | 2L | 5327503..5327677 | 13..187 | 875 | 100 | Plus |
2L | 23513712 | 2L | 5327744..5327807 | 187..250 | 320 | 100 | Plus |
Blast to na_te.dros performed on 2015-02-04 21:07:16 has no hits.
BS16804.5prime Sim4 Records
Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-15 17:20:50 Download gff for
BS16804.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG14028-PA | 1..234 | 17..250 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-10 21:29:24 Download gff for
BS16804.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
cype-RA | 60..301 | 12..255 | 99 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-04 21:54:57 Download gff for
BS16804.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
cype-RA | 60..301 | 12..255 | 99 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-04 21:54:57 Download gff for
BS16804.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2L | 5327496..5327676 | 5..186 | 98 | -> | Plus |
2L | 5327744..5327810 | 187..255 | 97 | | Plus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-10 21:29:24 Download gff for
BS16804.5prime
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_2L | 5327496..5327676 | 5..186 | 98 | -> | Plus |
arm_2L | 5327744..5327810 | 187..255 | 97 | | Plus |
BS16804.pep Sequence
Translation from 16 to 249
> BS16804.pep
MANTPATSSAGPVLRGLHNATIKRNLAVSLGLTAVVTIAYKILVNDPKKA
AYADFYSKYDANKSFERMKAAGRFQSC*
BS16804.pep Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 05:58:14
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
cype-PC | 77 | CG14028-PC | 1..77 | 1..77 | 388 | 100 | Plus |
cype-PB | 77 | CG14028-PB | 1..77 | 1..77 | 388 | 100 | Plus |
cype-PA | 77 | CG14028-PA | 1..77 | 1..77 | 388 | 100 | Plus |