Clone BS16821 Report

Search the DGRC for BS16821

Clone and Library Details

Library:BS
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with native stop reading frames
Original Plate Number:168
Well:21
Vector:pDNR-Dual
Associated Gene/Transcriptdro5-RA
Protein status:BS16821.pep: Imported from assembly
Sequenced Size:242

Clone Sequence Records

BS16821.complete Sequence

242 bp assembled on 2010-02-09

GenBank Submission: KX800343

> BS16821.complete
GAAGTTATCAGTCGACATGCAGATCAAGTTCCTGTACCTCTTCCTGGCTG
TGATGACCATCTTCATCCTGGGCGCCAAGGAAGCCGATGCCGACTGTCTC
TCTGGAAGATACGGAGGACCCTGCGCCGTCTGGGACAACGAGACCTGTCG
TCGGGTGTGCAAGGAGGAAGGACGATCCAGTGGCCACTGCAGTCCCAGTC
TGAAGTGCTGGTGCGAGGGATGCTAGAAGCTTTCTAGACCAT

BS16821.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 04:31:55
Subject Length Description Subject Range Query Range Score Percent Strand
Drsl5-RA 210 CG10812-PA 1..210 17..226 1050 100 Plus
Drs-RA 213 CG10810-PA 53..212 66..225 560 90 Plus
Drsl2-RA 213 CG32279-PA 5..211 18..224 450 81.2 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 04:31:56
Subject Length Description Subject Range Query Range Score Percent Strand
Drsl5-RA 364 CG10812-RA 53..264 15..226 1060 100 Plus
Drs-RA 387 CG10810-RA 116..275 66..225 560 90 Plus
Drsl2-RA 333 CG32279-RA 31..237 18..224 450 81.2 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 04:31:53
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 3316833..3317044 15..226 1060 100 Plus
3L 28110227 3L 3369671..3369830 66..225 560 90 Plus
3L 28110227 3L 3314379..3314585 18..224 450 81.2 Plus
3L 28110227 3L 3336146..3336359 224..17 420 80.8 Minus
3L 28110227 3L 3315784..3315842 158..216 205 89.8 Plus
3L 28110227 3L 3335580..3335639 225..166 195 88.3 Minus
Blast to na_te.dros performed on 2014-11-28 04:31:54 has no hits.

BS16821.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-02-09 18:12:03 Download gff for BS16821.complete
Subject Subject Range Query Range Percent Splice Strand
dro5-RA 27..236 17..226 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:01:14 Download gff for BS16821.complete
Subject Subject Range Query Range Percent Splice Strand
Drsl5-RA 55..264 17..226 100   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-09-23 18:24:35 Download gff for BS16821.complete
Subject Subject Range Query Range Percent Splice Strand
dro5-RA 27..236 17..226 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 05:31:03 Download gff for BS16821.complete
Subject Subject Range Query Range Percent Splice Strand
Drsl5-RA 55..264 17..226 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 05:31:03 Download gff for BS16821.complete
Subject Subject Range Query Range Percent Splice Strand
3L 3316835..3317044 17..226 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:01:14 Download gff for BS16821.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3L 3316835..3317044 17..226 100   Plus

BS16821.5prime Sequence

240 bp (240 high quality bases) assembled on 2007-05-15

> BS16821.5prime
GAAGTTATCAGTCGACATGCAGATCAAGTTCCTGTACCTCTTCCTGGCTG
TGATGACCATCTTCATCCTGGGCGCCAAGGAAGCCGATGCCGACTGTCTC
TCTGGAAGATACGGAGGACCCTGCGCCGTCTGGGACAACGAGACCTGTCG
TCGGGTGTGCAAGGAGGAAGGACGATCCAGTGGCCACTGCAGTCCCAGTC
TGAAGTGCTGGTGCGAGGGATGCTAGAAGCTTTCTAGACC

BS16821.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-15 17:19:00
Subject Length Description Subject Range Query Range Score Percent Strand
CG10812-PA 210 dro5-RA 1..210 17..226 1050 100 Plus
CG10810-PA 213 Drs-RA 106..212 119..225 385 94.3 Plus
CG32268-PA 219 dro6-RA 50..131 63..144 235 91.4 Plus
CG32279-PA 213 dro2-RA 165..211 178..224 185 95.7 Plus
CG32282-PA 216 dro4-RA 168..206 178..216 145 94.8 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-13 06:59:24
Subject Length Description Subject Range Query Range Score Percent Strand
Drsl5-RA 364 CG10812-RA 53..264 15..226 1060 100 Plus
Drs-RA 387 CG10810-RA 116..275 66..225 560 90 Plus
Drsl6-RA 387 CG32268-RA 60..273 17..224 460 82.2 Plus
Blast to na_all.dmel.RELEASE6 performed 2015-02-13 06:59:21
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 3316833..3317044 15..226 1060 100 Plus
3L 28110227 3L 3369671..3369830 66..225 560 90 Plus
3L 28110227 3L 3314379..3314585 18..224 450 81.2 Plus
3L 28110227 3L 3336146..3336359 224..17 420 80.8 Minus
3L 28110227 3L 3315784..3315842 158..216 205 89.8 Plus
3L 28110227 3L 3335580..3335639 225..166 195 88.3 Minus
Blast to na_te.dros performed on 2015-02-13 06:59:23 has no hits.

BS16821.5prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-15 17:19:03 Download gff for BS16821.5prime
Subject Subject Range Query Range Percent Splice Strand
CG10812-PA 1..210 17..226 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-09-01 20:47:48 Download gff for BS16821.5prime
Subject Subject Range Query Range Percent Splice Strand
Drsl5-RA 53..270 15..234 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-13 09:33:30 Download gff for BS16821.5prime
Subject Subject Range Query Range Percent Splice Strand
Drsl5-RA 53..270 15..234 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-13 09:33:30 Download gff for BS16821.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 3316833..3317050 15..234 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-09-01 20:47:48 Download gff for BS16821.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 3316833..3317050 15..234 98   Plus

BS16821.3prime Sequence

240 bp (240 high quality bases) assembled on 2007-05-15

> BS16821.3prime
ATGGTCTAGAAAGCTTCTAGCATCCCTCGCACCAGCACTTCAGACTGGGA
CTGCAGTGGCCACTGGATCGTCCTTCCTCCTTGCACACCCGACGACAGGT
CTCGTTGTCCCAGACGGCGCAGGGTCCTCCGTATCTTCCAGAGAGACAGT
CGGCATCGGCTTCCTTGGCGCCCAGGATGAAGATGGTCATCACAGCCAGG
AAGAGGTACAGGAACTTGATCTGCATGTCGACTGATAACT

BS16821.3prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-15 17:24:17
Subject Length Description Subject Range Query Range Score Percent Strand
CG10812-PA 210 dro5-RA 1..210 226..17 1050 100 Minus
CG10810-PA 213 Drs-RA 106..212 124..18 385 94.3 Minus
CG32268-PA 219 dro6-RA 50..131 180..99 235 91.4 Minus
CG32279-PA 213 dro2-RA 165..211 65..19 185 95.7 Minus
CG32282-PA 216 dro4-RA 168..206 65..27 145 94.8 Minus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-12 10:32:11
Subject Length Description Subject Range Query Range Score Percent Strand
Drsl5-RA 364 CG10812-RA 53..264 228..17 1060 100 Minus
Drs-RA 387 CG10810-RA 116..275 177..18 560 90 Minus
Drsl6-RA 387 CG32268-RA 60..273 226..19 460 82.2 Minus
Blast to na_all.dmel.RELEASE6 performed 2015-02-12 10:32:08
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 3316833..3317044 228..17 1060 100 Minus
3L 28110227 3L 3369671..3369830 177..18 560 90 Minus
3L 28110227 3L 3314379..3314585 225..19 450 81.2 Minus
3L 28110227 3L 3336146..3336359 19..226 420 80.8 Plus
3L 28110227 3L 3315784..3315842 85..27 205 89.8 Minus
3L 28110227 3L 3335580..3335639 18..77 195 88.3 Plus
Blast to na_te.dros performed on 2015-02-12 10:32:09 has no hits.

BS16821.3prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-15 17:24:19 Download gff for BS16821.3prime
Subject Subject Range Query Range Percent Splice Strand
CG10812-PA 1..210 17..226 100   Minus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-29 20:49:48 Download gff for BS16821.3prime
Subject Subject Range Query Range Percent Splice Strand
Drsl5-RA 53..270 9..228 98   Minus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-12 13:16:56 Download gff for BS16821.3prime
Subject Subject Range Query Range Percent Splice Strand
Drsl5-RA 53..270 9..228 98   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-12 13:16:56 Download gff for BS16821.3prime
Subject Subject Range Query Range Percent Splice Strand
3L 3316833..3317050 9..228 98   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-29 20:49:48 Download gff for BS16821.3prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 3316833..3317050 9..228 98   Minus

BS16821.pep Sequence

Translation from 219 to 236

> BS16821.pep
MLEAF*
Sequence BS16821.pep has no blast hits.