Clone BS17047 Report

Search the DGRC for BS17047

Clone and Library Details

Library:BS
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with native stop reading frames
Original Plate Number:170
Well:47
Vector:pDNR-Dual
Associated Gene/TranscriptMst84Dd-RA
Protein status:BS17047.pep: full length peptide match
Sequenced Size:16

Clone Sequence Records

BS17047.3prime Sequence

249 bp (249 high quality bases) assembled on 2007-05-15

> BS17047.3prime
ATGGTCTAGAAAGCTTCTAAAAAGGACAGCACCGCTGAAGGCCATTTCGT
TTTTCCATAGTGCCACAGCACGGTCCACAGGGTCCGCAAGGGCCACAACG
AGGTCCACAGGGGCCACAGCAGGGCCCGCAAGGTCCACAACAGGGTCCAC
AACAGGGTCCACAACAGGGTCCACAACAGGGTCCGCAACACGGTCCACAG
GGTCCGCAGCAAGGTCCGCCCGGTGCACAGCCCATGTCGACTGATAACT

BS17047.3prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-15 17:59:27
Subject Length Description Subject Range Query Range Score Percent Strand
CG17935-PA 219 Mst84Dd-RA 1..219 235..17 1095 100 Minus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-10 15:05:37
Subject Length Description Subject Range Query Range Score Percent Strand
Mst84Dd-RA 415 CG17935-RA 104..324 237..17 1105 100 Minus
Mst84Dc-RB 359 CG17945-RB 87..196 211..102 215 80.5 Minus
Mst84Dc-RA 363 CG17945-RA 91..200 211..102 215 80.5 Minus
Blast to na_all.dmel.RELEASE6 performed 2015-02-10 15:05:29
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 7363398..7363618 17..237 1105 100 Plus
Blast to na_te.dros performed on 2015-02-10 15:05:33 has no hits.

BS17047.3prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-15 17:59:29 Download gff for BS17047.3prime
Subject Subject Range Query Range Percent Splice Strand
CG17935-PA 1..219 17..235 100   Minus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-15 06:20:02 Download gff for BS17047.3prime
Subject Subject Range Query Range Percent Splice Strand
Mst84Dd-RA 104..324 17..237 100   Minus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-10 18:13:57 Download gff for BS17047.3prime
Subject Subject Range Query Range Percent Splice Strand
Mst84Dd-RA 104..324 17..237 100   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-10 18:13:57 Download gff for BS17047.3prime
Subject Subject Range Query Range Percent Splice Strand
3R 7363398..7363618 17..237 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-15 06:20:02 Download gff for BS17047.3prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 3189120..3189340 17..237 100   Plus

BS17047.5prime Sequence

249 bp (249 high quality bases) assembled on 2007-05-15

> BS17047.5prime
GAAGTTATCAGTCGACATGGGCTGTGCACCGGGCGGACCTTGCTGCGGAC
CCTGTGGACCGTGTTGCGGACCCTGTTGTGGACCCTGTTGTGGACCCTGT
TGTGGACCCTGTTGTGGACCTTGCGGGCCCTGCTGTGGCCCCTGTGGACC
TCGTTGTGGCCCTTGCGGACCCTGTGGACCGTGCTGTGGCACTATGGAAA
AACGAAATGGCCTTCAGCGGTGCTGTCCTTTTTAGAAGCTTTCTAGACC

BS17047.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-15 17:55:34
Subject Length Description Subject Range Query Range Score Percent Strand
CG17935-PA 219 Mst84Dd-RA 1..219 17..235 1095 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-11 02:30:31
Subject Length Description Subject Range Query Range Score Percent Strand
Mst84Dd-RA 415 CG17935-RA 104..324 15..235 1105 100 Plus
Mst84Dc-RB 359 CG17945-RB 87..196 41..150 215 80.5 Plus
Mst84Dc-RA 363 CG17945-RA 91..200 41..150 215 80.5 Plus
Blast to na_all.dmel.RELEASE6 performed 2015-02-11 02:30:28
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 7363398..7363618 235..15 1105 100 Minus
Blast to na_te.dros performed on 2015-02-11 02:30:30 has no hits.

BS17047.5prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-15 17:55:36 Download gff for BS17047.5prime
Subject Subject Range Query Range Percent Splice Strand
CG17935-PA 1..219 17..235 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-22 21:00:49 Download gff for BS17047.5prime
Subject Subject Range Query Range Percent Splice Strand
Mst84Dd-RA 104..324 15..235 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-11 05:06:40 Download gff for BS17047.5prime
Subject Subject Range Query Range Percent Splice Strand
Mst84Dd-RA 104..324 15..235 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-11 05:06:40 Download gff for BS17047.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 7363398..7363618 15..235 100   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-22 21:00:49 Download gff for BS17047.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 3189120..3189340 15..235 100   Minus

BS17047.complete Sequence

251 bp assembled on 2007-05-08

GenBank Submission: FJ638235

> BS17047.complete
GAAGTTATCAGTCGACATGGGCTGTGCACCGGGCGGACCTTGCTGCGGAC
CCTGTGGACCGTGTTGCGGACCCTGTTGTGGACCCTGTTGTGGACCCTGT
TGTGGACCCTGTTGTGGACCTTGCGGGCCCTGCTGTGGCCCCTGTGGACC
TCGTTGTGGCCCTTGCGGACCCTGTGGACCGTGCTGTGGCACTATGGAAA
AACGAAATGGCCTTCAGCGGTGCTGTCCTTTTTAGAAGCTTTCTAGACCA
T

BS17047.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-27 16:16:04
Subject Length Description Subject Range Query Range Score Percent Strand
Mst84Dd-RA 219 CG17935-PA 1..219 17..235 1095 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 16:16:05
Subject Length Description Subject Range Query Range Score Percent Strand
Mst84Dd-RA 415 CG17935-RA 104..324 15..235 1105 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 16:16:02
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 7363398..7363618 235..15 1105 100 Minus
Blast to na_te.dros performed on 2014-11-27 16:16:03 has no hits.

BS17047.complete Sim4 Records

Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 14:01:56 Download gff for BS17047.complete
Subject Subject Range Query Range Percent Splice Strand
Mst84Dd-RA 1..219 17..235 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-11 02:12:59 Download gff for BS17047.complete
Subject Subject Range Query Range Percent Splice Strand
Mst84Dd-RA 104..324 15..235 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 18:51:33 Download gff for BS17047.complete
Subject Subject Range Query Range Percent Splice Strand
Mst84Dd-RA 106..324 17..235 100   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 14:01:56 Download gff for BS17047.complete
Subject Subject Range Query Range Percent Splice Strand
Mst84Dd-RA 104..324 15..235 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 17:14:46 Download gff for BS17047.complete
Subject Subject Range Query Range Percent Splice Strand
Mst84Dd-RA 106..324 17..235 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 17:14:46 Download gff for BS17047.complete
Subject Subject Range Query Range Percent Splice Strand
3R 7363398..7363616 17..235 100   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 18:51:33 Download gff for BS17047.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3R 3189120..3189338 17..235 100   Minus

BS17047.pep Sequence

Translation from 16 to 234

> BS17047.pep
MGCAPGGPCCGPCGPCCGPCCGPCCGPCCGPCCGPCGPCCGPCGPRCGPC
GPCGPCCGTMEKRNGLQRCCPF*

BS17047.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 02:22:50
Subject Length Description Subject Range Query Range Score Percent Strand
Mst84Dd-PA 72 CG17935-PA 1..72 1..72 510 100 Plus
Mst84Db-PA 74 CG17934-PA 9..66 3..58 265 71.7 Plus
Mst84Dc-PB 55 CG17945-PB 2..51 9..58 259 80.8 Plus
Mst84Dc-PA 55 CG17945-PA 2..51 9..58 259 80.8 Plus
Mst84Db-PA 74 CG17934-PA 12..73 3..58 257 70.3 Plus
Mst87F-PB 56 CG17956-PB 2..52 9..58 257 79.2 Plus
Mst84Db-PA 74 CG17934-PA 2..65 9..70 224 61.2 Plus
Mst84Dc-PB 55 CG17945-PB 16..53 7..43 201 79.5 Plus
Mst84Dc-PA 55 CG17945-PA 16..53 7..43 201 79.5 Plus
Mst84Dc-PB 55 CG17945-PB 1..53 1..50 195 63.6 Plus
Mst84Dc-PA 55 CG17945-PA 1..53 1..50 195 63.6 Plus