Clone BS17160 Report

Search the DGRC for BS17160

Clone and Library Details

Library:BS
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with native stop reading frames
Original Plate Number:171
Well:60
Vector:pDNR-Dual
Associated Gene/Transcriptrpr-RA
Protein status:BS17160.pep: Imported from assembly
Sequenced Size:231

Clone Sequence Records

BS17160.complete Sequence

231 bp assembled on 2010-02-09

GenBank Submission: KX806547

> BS17160.complete
GAAGTTATCAGTCGACATGGCAGTGGCATTCTACATACCCGATCAGGCGA
CTCTGTTGCGGGAGGCGGAGCAGAAGGAGCAGCAGATCCTTCGCTTGCGG
GAGTCACAGTGGAGATTCCTGGCCACCGTCGTCCTGGAAACCCTGCGCCA
GTACACTTCATGTCATCCGAAGACCGGAAGAAAGTCCGGCAAATATCGCA
AGCCATCGCAATGAAAAGCTTTCTAGACCAT

BS17160.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 04:31:50
Subject Length Description Subject Range Query Range Score Percent Strand
rpr-RA 198 CG4319-PA 1..198 17..214 990 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 04:31:51
Subject Length Description Subject Range Query Range Score Percent Strand
rpr-RA 901 CG4319-RA 201..398 17..214 990 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 04:31:48
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 18398038..18398235 214..17 990 100 Minus
Blast to na_te.dros performed on 2014-11-28 04:31:49 has no hits.

BS17160.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-02-09 18:12:02 Download gff for BS17160.complete
Subject Subject Range Query Range Percent Splice Strand
rpr-RA 169..365 17..213 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:01:13 Download gff for BS17160.complete
Subject Subject Range Query Range Percent Splice Strand
rpr-RA 201..397 17..213 100   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-09-23 18:24:37 Download gff for BS17160.complete
Subject Subject Range Query Range Percent Splice Strand
rpr-RA 169..365 17..213 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 05:31:01 Download gff for BS17160.complete
Subject Subject Range Query Range Percent Splice Strand
rpr-RA 201..397 17..213 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 05:31:01 Download gff for BS17160.complete
Subject Subject Range Query Range Percent Splice Strand
3L 18398039..18398235 17..213 100   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:01:13 Download gff for BS17160.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3L 18391139..18391335 17..213 100   Minus

BS17160.3prime Sequence

229 bp (229 high quality bases) assembled on 2007-05-15

> BS17160.3prime
ATGGTCTAGAAAGCTTTTCATTGCGATGGCTTGCGATATTTGCCGGACTT
TCTTCCGGTCTTCGGATGACATGAAGTGTACTGGCGCAGGGTTTCCAGGA
CGACGGTGGCCAGGAATCTCCACTGTGACTCCCGCAAGCGAAGGATCTGC
TGCTCCTTCTGCTCCGCCTCCCGCAACAGAGTCGCCTGATCGGGTATGTA
GAATGCCACTGCCATGTCGACTGATAACT

BS17160.3prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-15 18:08:34
Subject Length Description Subject Range Query Range Score Percent Strand
CG4319-PA 198 rpr-RA 1..198 215..18 990 100 Minus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-12 05:37:23
Subject Length Description Subject Range Query Range Score Percent Strand
rpr-RA 901 CG4319-RA 201..398 215..18 990 100 Minus
Blast to na_all.dmel.RELEASE6 performed 2015-02-12 05:37:18
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 18398038..18398235 18..215 990 100 Plus
Blast to na_te.dros performed on 2015-02-12 05:37:21 has no hits.

BS17160.3prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-15 18:08:36 Download gff for BS17160.3prime
Subject Subject Range Query Range Percent Splice Strand
CG4319-PA 1..198 18..215 100   Minus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-29 05:44:49 Download gff for BS17160.3prime
Subject Subject Range Query Range Percent Splice Strand
rpr-RA 196..403 11..223 96   Minus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-12 07:42:33 Download gff for BS17160.3prime
Subject Subject Range Query Range Percent Splice Strand
rpr-RA 196..403 11..223 96   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-12 07:42:33 Download gff for BS17160.3prime
Subject Subject Range Query Range Percent Splice Strand
3L 18398033..18398240 11..223 96   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-29 05:44:49 Download gff for BS17160.3prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 18391133..18391340 11..223 96   Plus

BS17160.5prime Sequence

229 bp (229 high quality bases) assembled on 2007-05-15

> BS17160.5prime
GAAGTTATCAGTCGACATGGCAGTGGCATTCTACATACCCGATCAGGCGA
CTCTGTTGCGGGAGGCGGAGCAGAAGGAGCAGCAGATCCTTCGCTTGCGG
GAGTCACAGTGGAGATTCCTGGCCACCGTCGTCCTGGAAACCCTGCGCCA
GTACACTTCATGTCATCCGAAGACCGGAAGAAAGTCCGGCAAATATCGCA
AGCCATCGCAATGAAAAGCTTTCTAGACC

BS17160.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-15 18:04:22
Subject Length Description Subject Range Query Range Score Percent Strand
CG4319-PA 198 rpr-RA 1..198 17..214 990 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-12 05:35:07
Subject Length Description Subject Range Query Range Score Percent Strand
rpr-RA 901 CG4319-RA 201..398 17..214 990 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2015-02-12 05:35:02
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 18398038..18398235 214..17 990 100 Minus
Blast to na_te.dros performed on 2015-02-12 05:35:04 has no hits.

BS17160.5prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-15 18:04:23 Download gff for BS17160.5prime
Subject Subject Range Query Range Percent Splice Strand
CG4319-PA 1..198 17..214 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-29 05:44:14 Download gff for BS17160.5prime
Subject Subject Range Query Range Percent Splice Strand
rpr-RA 196..403 9..221 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-12 07:36:43 Download gff for BS17160.5prime
Subject Subject Range Query Range Percent Splice Strand
rpr-RA 196..403 9..221 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-12 07:36:43 Download gff for BS17160.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 18398033..18398240 9..221 96   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-29 05:44:14 Download gff for BS17160.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 18391133..18391340 9..221 96   Minus

BS17160.pep Sequence

Translation from 159 to 231

> BS17160.pep
MSSEDRKKVRQISQAIAMKSFLDH
Sequence BS17160.pep has no blast hits.