Clone BS17231 Report

Search the DGRC for BS17231

Clone and Library Details

Library:BS
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with native stop reading frames
Original Plate Number:172
Well:31
Vector:pDNR-Dual
Associated Gene/TranscriptCG30430-RA
Protein status:BS17231.pep: full length peptide match
Sequenced Size:188

Clone Sequence Records

BS17231.3prime Sequence

186 bp (186 high quality bases) assembled on 2007-05-15

> BS17231.3prime
ATGGTCTAGAAAGCTTTTAACAAGACGGTCCGCAGCTGCTGCAGCATCCG
CCCCCGCAGCAAGGTCCACATGGTCCACTATAGAATCCGCATCGTGGTCC
AAAACAACGGCCACTAAAGCAGGGGCTACAGCAAGGGTAGTAGCAAGTTC
CACAGCAGGGCCCGCAACACATGTCGACTGATAACT

BS17231.3prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-15 18:17:43
Subject Length Description Subject Range Query Range Score Percent Strand
CG30430-PA 156 CG30430-RA 1..156 172..17 780 100 Minus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-10 17:41:06
Subject Length Description Subject Range Query Range Score Percent Strand
CG30430-RB 355 CG30430-RB 97..252 172..17 780 100 Minus
CG30430-RA 498 CG30430-RA 124..279 172..17 780 100 Minus
Blast to na_all.dmel.RELEASE6 performed 2015-02-10 17:40:59
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 25129611..25129766 172..17 780 100 Minus
Blast to na_te.dros performed on 2015-02-10 17:41:03 has no hits.

BS17231.3prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-15 18:17:45 Download gff for BS17231.3prime
Subject Subject Range Query Range Percent Splice Strand
CG30430-PA 1..156 17..172 100   Minus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-15 06:16:49 Download gff for BS17231.3prime
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 119..282 10..177 96   Minus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-10 18:38:51 Download gff for BS17231.3prime
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 119..282 10..177 96   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-10 18:38:51 Download gff for BS17231.3prime
Subject Subject Range Query Range Percent Splice Strand
2R 25129606..25129769 10..177 96   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-15 06:16:49 Download gff for BS17231.3prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 21017129..21017292 10..177 96   Minus

BS17231.5prime Sequence

186 bp (186 high quality bases) assembled on 2007-05-15

> BS17231.5prime
GAAGTTATCAGTCGACATGTGTTGCGGGCCCTGCTGTGGAACTTGCTACT
ACCCTTGCTGTAGCCCCTGCTTTAGTGGCCGTTGTTTTGGACCACGATGC
GGATTCTATAGTGGACCATGTGGACCTTGCTGCGGGGGCGGATGCTGCAG
CAGCTGCGGACCGTCTTGTTAAAAGCTTTCTAGACC

BS17231.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-15 18:11:02
Subject Length Description Subject Range Query Range Score Percent Strand
CG30430-PA 156 CG30430-RA 1..156 17..172 780 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-12 05:38:46
Subject Length Description Subject Range Query Range Score Percent Strand
CG30430-RB 355 CG30430-RB 97..252 17..172 780 100 Plus
CG30430-RA 498 CG30430-RA 124..279 17..172 780 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2015-02-12 05:38:42
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 25129611..25129766 17..172 780 100 Plus
Blast to na_te.dros performed on 2015-02-12 05:38:44 has no hits.

BS17231.5prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-15 18:11:05 Download gff for BS17231.5prime
Subject Subject Range Query Range Percent Splice Strand
CG30430-PA 1..156 17..172 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-29 05:45:06 Download gff for BS17231.5prime
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 119..282 12..179 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-12 07:45:54 Download gff for BS17231.5prime
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 119..282 12..179 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-12 07:45:54 Download gff for BS17231.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 25129606..25129769 12..179 96   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-29 05:45:06 Download gff for BS17231.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 21017129..21017292 12..179 96   Plus

BS17231.complete Sequence

188 bp assembled on 2012-04-25

GenBank Submission: KX804429

> BS17231.complete
GAAGTTATCAGTCGACATGTGTTGCGGGCCCTGCTGTGGAACTTGCTACT
ACCCTTGCTGTAGCCCCTGCTTTAGTGGCCGTTGTTTTGGACCACGATGC
GGATTCTATAGTGGACCATGTGGACCTTGCTGCGGGGGCGGATGCTGCAG
CAGCTGCGGACCGTCTTGTTAAAAGCTTTCTAGACCAT

BS17231.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 11:57:29
Subject Length Description Subject Range Query Range Score Percent Strand
CG30430-RB 156 CG30430-PB 1..156 17..172 780 100 Plus
CG30430-RA 156 CG30430-PA 1..156 17..172 780 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 11:57:30
Subject Length Description Subject Range Query Range Score Percent Strand
CG30430-RB 355 CG30430-RB 97..252 17..172 780 100 Plus
CG30430-RA 498 CG30430-RA 124..279 17..172 780 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 11:57:27
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 25129611..25129766 17..172 780 100 Plus
Blast to na_te.dros performed on 2014-11-28 11:57:28 has no hits.

BS17231.complete Sim4 Records

Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 23:18:21 Download gff for BS17231.complete
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 1..156 17..172 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2009-07-28 15:36:55 Download gff for BS17231.complete
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 124..277 17..170 100   Plus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2012-04-25 15:16:53 Download gff for BS17231.complete
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 124..277 17..170 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:35:49 Download gff for BS17231.complete
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 124..277 17..170 100   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 23:18:21 Download gff for BS17231.complete
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 119..282 12..179 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 12:54:16 Download gff for BS17231.complete
Subject Subject Range Query Range Percent Splice Strand
CG30430-RA 124..277 17..170 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 12:54:16 Download gff for BS17231.complete
Subject Subject Range Query Range Percent Splice Strand
2R 25129611..25129764 17..170 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:35:49 Download gff for BS17231.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2R 21017134..21017287 17..170 100   Plus

BS17231.pep Sequence

Translation from 16 to 171

> BS17231.pep
MCCGPCCGTCYYPCCSPCFSGRCFGPRCGFYSGPCGPCCGGGCCSSCGPS
C*

BS17231.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 08:24:40
Subject Length Description Subject Range Query Range Score Percent Strand
CG30430-PB 51 CG30430-PB 1..51 1..51 351 100 Plus
CG30430-PA 51 CG30430-PA 1..51 1..51 351 100 Plus
Mst84Dd-PA 72 CG17935-PA 7..57 4..51 169 58.5 Plus
Mst84Dc-PB 55 CG17945-PB 1..53 1..47 162 56.4 Plus
Mst84Dc-PA 55 CG17945-PA 1..53 1..47 162 56.4 Plus
Mst84Dd-PA 72 CG17935-PA 24..58 2..40 144 61.9 Plus