Clone BS17319 Report

Search the DGRC for BS17319

Clone and Library Details

Library:BS
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with native stop reading frames
Original Plate Number:173
Well:19
Vector:pDNR-Dual
Associated Gene/TranscriptCG13838-RA
Protein status:BS17319.pep: full length peptide match
Sequenced Size:308

Clone Sequence Records

BS17319.complete Sequence

308 bp assembled on 2010-02-09

GenBank Submission: KX800769

> BS17319.complete
GAAGTTATCAGTCGACATGGACAGCGCCGATGAGCAGCTGCAGCTGGATC
TGGACAGGATATCGATGGAGAGTCGCCAGGCCAGCAGTTTCGATGACCTC
ATCGAGCTGACCAACAACTCGGAGCGTCTGATGGCCAGAGTCAATTCCAG
CTTGGATGACCTAAACACCGCCCTCGACAACCTGGAGGCTCGAACGGACC
GGGTTCTGGTCGAGATTCGGAGGCTAATCAGCTCGGAAATGCCGGCACAA
GGTCCGCACGATGGATGTGGCGATCCAGATGCCAGGGCGTAGAAGCTTTC
TAGACCAT

BS17319.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 03:13:03
Subject Length Description Subject Range Query Range Score Percent Strand
CG13838-RA 276 CG13838-PA 1..276 17..292 1380 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 03:13:05
Subject Length Description Subject Range Query Range Score Percent Strand
CG13838-RA 429 CG13838-RA 93..368 17..292 1380 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 03:13:01
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 23042333..23042608 17..292 1380 100 Plus
Blast to na_te.dros performed on 2014-11-28 03:13:02 has no hits.

BS17319.complete Sim4 Records

Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-22 00:46:15 Download gff for BS17319.complete
Subject Subject Range Query Range Percent Splice Strand
CG13838-RA 1..276 17..292 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-02-09 18:16:41 Download gff for BS17319.complete
Subject Subject Range Query Range Percent Splice Strand
CG13838-RA 93..368 17..292 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 21:38:22 Download gff for BS17319.complete
Subject Subject Range Query Range Percent Splice Strand
CG13838-RA 93..368 17..292 100   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-22 00:46:15 Download gff for BS17319.complete
Subject Subject Range Query Range Percent Splice Strand
CG13838-RA 82..370 5..296 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 03:45:23 Download gff for BS17319.complete
Subject Subject Range Query Range Percent Splice Strand
CG13838-RA 93..368 17..292 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 03:45:23 Download gff for BS17319.complete
Subject Subject Range Query Range Percent Splice Strand
3R 23042333..23042608 17..292 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 21:38:22 Download gff for BS17319.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3R 18868055..18868330 17..292 100   Plus

BS17319.3prime Sequence

306 bp (306 high quality bases) assembled on 2007-05-15

> BS17319.3prime
ATGGTCTAGAAAGCTTCTACGCCCTGGCATCTGGATCGCCACATCCATCG
TGCGGACCTTGTGCCGGCATTTCCGAGCTGATTAGCCTCCGAATCTCGAC
CAGAACCCGGTCCGTTCGAGCCTCCAGGTTGTCGAGGGCGGTGTTTAGGT
CATCCAAGCTGGAATTGACTCTGGCCATCAGACGCTCCGAGTTGTTGGTC
AGCTCGATGAGGTCATCGAAACTGCTGGCCTGGCGACTCTCCATCGATAT
CCTGTCCAGATCCAGCTGCAGCTGCTCATCGGCGCTGTCCATGTCGACTG
ATAACT

BS17319.3prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-15 18:31:33
Subject Length Description Subject Range Query Range Score Percent Strand
CG13838-PA 276 CG13838-RA 1..276 292..17 1380 100 Minus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-13 12:05:38
Subject Length Description Subject Range Query Range Score Percent Strand
CG13838-RA 429 CG13838-RA 93..368 292..17 1380 100 Minus
Blast to na_all.dmel.RELEASE6 performed 2015-02-13 12:05:37
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 23042333..23042608 292..17 1380 100 Minus
Blast to na_te.dros performed on 2015-02-13 12:05:37 has no hits.

BS17319.3prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-15 18:31:34 Download gff for BS17319.3prime
Subject Subject Range Query Range Percent Splice Strand
CG13838-PA 1..276 17..292 100   Minus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-09-02 17:57:32 Download gff for BS17319.3prime
Subject Subject Range Query Range Percent Splice Strand
CG13838-RA 82..370 13..304 97   Minus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-13 14:25:05 Download gff for BS17319.3prime
Subject Subject Range Query Range Percent Splice Strand
CG13838-RA 82..370 13..304 97   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-13 14:25:05 Download gff for BS17319.3prime
Subject Subject Range Query Range Percent Splice Strand
3R 23042322..23042610 13..304 97   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-09-02 17:57:32 Download gff for BS17319.3prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 18868044..18868332 13..304 97   Minus

BS17319.5prime Sequence

306 bp (306 high quality bases) assembled on 2007-05-15

> BS17319.5prime
GAAGTTATCAGTCGACATGGACAGCGCCGATGAGCAGCTGCAGCTGGATC
TGGACAGGATATCGATGGAGAGTCGCCAGGCCAGCAGTTTCGATGACCTC
ATCGAGCTGACCAACAACTCGGAGCGTCTGATGGCCAGAGTCAATTCCAG
CTTGGATGACCTAAACACCGCCCTCGACAACCTGGAGGCTCGAACGGACC
GGGTTCTGGTCGAGATTCGGAGGCTAATCAGCTCGGAAATGCCGGCACAA
GGTCCGCACGATGGATGTGGCGATCCAGATGCCAGGGCGTAGAAGCTTTC
TAGACC

BS17319.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-05-15 18:24:22
Subject Length Description Subject Range Query Range Score Percent Strand
CG13838-PA 276 CG13838-RA 1..276 17..292 1380 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-13 15:14:57
Subject Length Description Subject Range Query Range Score Percent Strand
CG13838-RA 429 CG13838-RA 93..368 17..292 1380 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2015-02-13 15:14:53
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 23042333..23042608 17..292 1380 100 Plus
Blast to na_te.dros performed on 2015-02-13 15:14:55 has no hits.

BS17319.5prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-05-15 18:24:24 Download gff for BS17319.5prime
Subject Subject Range Query Range Percent Splice Strand
CG13838-PA 1..276 17..292 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-09-03 11:50:31 Download gff for BS17319.5prime
Subject Subject Range Query Range Percent Splice Strand
CG13838-RA 82..370 5..296 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-13 16:58:39 Download gff for BS17319.5prime
Subject Subject Range Query Range Percent Splice Strand
CG13838-RA 82..370 5..296 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-13 16:58:39 Download gff for BS17319.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 23042322..23042610 5..296 97   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-09-03 11:50:31 Download gff for BS17319.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 18868044..18868332 5..296 97   Plus

BS17319.pep Sequence

Translation from 16 to 291

> BS17319.pep
MDSADEQLQLDLDRISMESRQASSFDDLIELTNNSERLMARVNSSLDDLN
TALDNLEARTDRVLVEIRRLISSEMPAQGPHDGCGDPDARA*

BS17319.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 02:50:15
Subject Length Description Subject Range Query Range Score Percent Strand
CG13838-PA 91 CG13838-PA 1..91 1..91 453 100 Plus