Clone BS18125 Report

Search the DGRC for BS18125

Clone and Library Details

Library:BS
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with native stop reading frames
Original Plate Number:181
Well:25
Vector:pDNR-Dual
Associated Gene/TranscriptCG32188-RA
Protein status:BS18125.pep: full length peptide match
Sequenced Size:350

Associated Genes

Associations are from manual ordering of a clone or by a periodic analysis.
Gene Date Evidence
CG32189-RA 2009-01-21 est gleaning

Clone Sequence Records

BS18125.3prime Sequence

348 bp (348 high quality bases) assembled on 2007-06-06

> BS18125.3prime
ATGGTCTAGAAAGCTTTCAGCCGGCCGGCCTGCGAACGCGTACGACGACC
CGTCGGCGATTGTCTCCGCTCTCACTTCGTCCTTCCCTGCCACGGCGGAT
GATCACGCGCCTGATGATGACACGGCGGCGTCGGTGCTTCTTCTTTGTGG
AGGCAGTGGTGGTCGTGGAGGATTCGGTGGTGGTGGTGGTGGACGAATCA
GTTGTTGTCGTAGCAGCCGTGGTGGTTGTGGCCGAAGCACTTGTGGAGGT
GGTGGTTGATGTGGAGGACACCTGGCTGCTGTGGAGGATCAGAACGACCA
GGACGGCCAGGGAGAGAGCTAGTAGAAAGCGCATGTCGACTGATAACT

BS18125.3prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-08-06 12:12:33
Subject Length Description Subject Range Query Range Score Percent Strand
CG32189-PA 318 CG32189-RA 1..312 334..23 1535 99.6 Minus
CG32188-PA 318 CG32188-RA 1..312 334..23 1435 98.3 Minus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-05 14:17:01
Subject Length Description Subject Range Query Range Score Percent Strand
CG32189-RA 430 CG32189-RA 29..353 339..15 1565 98.8 Minus
CG32188-RA 349 CG32188-RA 27..343 339..23 1495 98.1 Minus
Blast to na_all.dmel.RELEASE6 performed 2015-02-05 14:16:52
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 17834822..17835146 15..339 1565 98.8 Plus
3L 28110227 3L 17833283..17833599 23..339 1495 98.1 Plus
Blast to na_te.dros performed on 2015-02-05 14:16:56 has no hits.

BS18125.3prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-08-06 12:12:35 Download gff for BS18125.3prime
Subject Subject Range Query Range Percent Splice Strand
CG32189-PA 1..318 17..334 99   Minus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-10 22:12:20 Download gff for BS18125.3prime
Subject Subject Range Query Range Percent Splice Strand
CG32189-RA 29..353 15..339 98   Minus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-05 16:18:30 Download gff for BS18125.3prime
Subject Subject Range Query Range Percent Splice Strand
CG32189-RA 29..353 15..339 98   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-05 16:18:30 Download gff for BS18125.3prime
Subject Subject Range Query Range Percent Splice Strand
3L 17834822..17835146 15..339 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-10 22:12:20 Download gff for BS18125.3prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 17827922..17828246 15..339 98   Plus

BS18125.complete Sequence

350 bp assembled on 2009-10-21

GenBank Submission: KX800477

> BS18125.complete
GAAGTTATCAGTCGACATGCGCTTTCTACTAGCTCTCTCCCTGGCCGTCC
TGGTCGTTCTGATCCTCCACAGCAGCCAGGTGTCCTCCACATCAACCACC
ACCTCCACAAGTGCTTCGGCCACAACCACCACGGCTGCTACGACAACAAC
TGATTCGTCCACCACCACCACCACCGAATCCTCCACGACCACCACTGCCT
CCACAAAGAAGAAGCACCGACGCCGCCGTGTCATCATCAGGCGCGTGATC
ATCCGCCGTGGCAGGGAAGGACGAAGTGAGAGCGGAGACAATCGCCGACG
GGTCGTCGTACGCGTTCGCAGGACGGCCAACTGAAAGCTTTCTAGACCAT

BS18125.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-27 07:09:02
Subject Length Description Subject Range Query Range Score Percent Strand
CG32189-RA 318 CG32189-PA 1..318 17..334 1590 100 Plus
CG32188-RA 318 CG32188-PA 1..316 17..332 1520 98.7 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 07:09:03
Subject Length Description Subject Range Query Range Score Percent Strand
CG32189-RA 430 CG32189-RA 29..353 12..336 1610 99.7 Plus
CG32188-RA 349 CG32188-RA 27..347 12..332 1530 98.4 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 07:09:01
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 17834822..17835146 336..12 1610 99.7 Minus
3L 28110227 3L 17833279..17833599 332..12 1530 98.4 Minus
Blast to na_te.dros performed on 2014-11-27 07:09:01 has no hits.

BS18125.complete Sim4 Records

Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 23:25:59 Download gff for BS18125.complete
Subject Subject Range Query Range Percent Splice Strand
CG32189-RA 1..318 17..334 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2009-10-21 17:47:00 Download gff for BS18125.complete
Subject Subject Range Query Range Percent Splice Strand
CG32189-RA 34..350 17..333 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 05:06:53 Download gff for BS18125.complete
Subject Subject Range Query Range Percent Splice Strand
CG32189-RA 34..350 17..333 100   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 23:25:59 Download gff for BS18125.complete
Subject Subject Range Query Range Percent Splice Strand
CG32189-RA 29..353 12..336 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 08:04:14 Download gff for BS18125.complete
Subject Subject Range Query Range Percent Splice Strand
CG32189-RA 34..350 17..333 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 08:04:14 Download gff for BS18125.complete
Subject Subject Range Query Range Percent Splice Strand
3L 17834825..17835141 17..333 100   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 05:06:53 Download gff for BS18125.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3L 17827925..17828241 17..333 100   Minus

BS18125.5prime Sequence

348 bp (348 high quality bases) assembled on 2007-06-06

> BS18125.5prime
GAAGTTATCACTCGACATGCGCTTTCTACTAGCTCTCTCCCTGGCCGTCC
TGGTCGTTCTGATCCTCCACAGCAGCCAGGTGTCCTCCACATCAACCACC
ACCTCCACAAGTGCTTCGGCCACAACCACCACGGCTGCTACGACAACAAC
TGATTCGTCCACCACCACCACCACCGAATCCTCCACGACCACCACTGCCT
CCACAAAGAAGAAGCACCGACGCCGCCGTGTCATCATCAGGCGCGTGATC
ATCCGCCGTGGCAGGGAAGGACGAAGTGAGAGCGGAGACAATCGCCGACG
GGTCGTCGTACGCGTTCGCAGGACGGCCAACTGAAAGCTTTCTAGACC

BS18125.5prime Blast Records

Blast to dmel-all-CDS-r5.1.fasta performed 2007-08-06 12:12:38
Subject Length Description Subject Range Query Range Score Percent Strand
CG32189-PA 318 CG32189-RA 1..318 17..334 1590 100 Plus
CG32188-PA 318 CG32188-RA 1..316 17..332 1480 98.7 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2015-02-11 05:19:01
Subject Length Description Subject Range Query Range Score Percent Strand
CG32189-RA 430 CG32189-RA 29..353 12..336 1610 99.7 Plus
CG32188-RA 349 CG32188-RA 27..347 12..332 1530 98.4 Plus
Blast to na_all.dmel.RELEASE6 performed 2015-02-11 05:18:59
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 17834822..17835146 336..12 1610 99.7 Minus
3L 28110227 3L 17833279..17833599 332..12 1530 98.4 Minus
Blast to na_te.dros performed on 2015-02-11 05:19:00 has no hits.

BS18125.5prime Sim4 Records

Sim4 to dmel-all-CDS-r5.1.fasta performed 2007-08-06 12:12:40 Download gff for BS18125.5prime
Subject Subject Range Query Range Percent Splice Strand
CG32189-PA 1..318 17..334 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-23 09:49:28 Download gff for BS18125.5prime
Subject Subject Range Query Range Percent Splice Strand
CG32189-RA 29..353 12..336 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2015-02-11 09:46:53 Download gff for BS18125.5prime
Subject Subject Range Query Range Percent Splice Strand
CG32189-RA 29..353 12..336 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2015-02-11 09:46:53 Download gff for BS18125.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 17834822..17835146 12..336 99   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-23 09:49:28 Download gff for BS18125.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 17827922..17828246 12..336 99   Minus

BS18125.pep Sequence

Translation from 16 to 333

> BS18125.pep
MRFLLALSLAVLVVLILHSSQVSSTSTTTSTSASATTTTAATTTTDSSTT
TTTESSTTTTASTKKKHRRRRVIIRRVIIRRGREGRSESGDNRRRVVVRV
RRTAN*

BS18125.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 06:01:44
Subject Length Description Subject Range Query Range Score Percent Strand
CG32189-PA 105 CG32189-PA 1..105 1..105 493 100 Plus
CG32188-PA 105 CG32188-PA 1..105 1..105 493 100 Plus
CG32071-PA 150 CG32071-PA 11..115 1..95 199 49.5 Plus
CG32453-PB 120 CG32453-PB 1..116 1..105 189 45.8 Plus
CG32453-PA 120 CG32453-PA 1..116 1..105 189 45.8 Plus