Clone BS22029 Report

Search the DGRC for BS22029

Clone and Library Details

Library:BS
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with native stop reading frames
Original Plate Number:220
Well:29
Vector:pDNR-Dual
Associated Gene/TranscriptMst87F-RA
Protein status:BS22029.pep: full length peptide match
Sequenced Size:203

Clone Sequence Records

BS22029.complete Sequence

203 bp assembled on 2011-01-25

GenBank Submission: KX805167

> BS22029.complete
GAAGTTATCAGTCGACATGTGCTGCGGACCCTGTGGACCCTGCTGCGGAC
CTTGCTGCGGACCCTGCTGTGGTCCATGCGGACCATGCGGAGGAGGATGT
GGACCCTGCTATGGACCGAATGTCTGCGGACCATGCTATGCCTGTGGACC
CTGTGGCGGCTGCTATTGTGGATACCCTTGCTGCTAGAAGCTTTCTAGAC
CAT

BS22029.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-26 15:16:29
Subject Length Description Subject Range Query Range Score Percent Strand
Mst87F-RB 171 CG17956-PB 1..171 17..187 855 100 Plus
Mst87F-RA 171 CG17956-PA 1..171 17..187 855 100 Plus
Mst84Dd-RA 219 CG17935-PA 25..77 20..72 175 88.7 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:16:31
Subject Length Description Subject Range Query Range Score Percent Strand
Mst87F-RB 515 CG17956-RB 195..367 16..188 865 100 Plus
Mst87F-RA 446 CG17956-RA 126..298 16..188 865 100 Plus
Mst84Dd-RA 415 CG17935-RA 130..182 20..72 175 88.7 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:16:27
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 13827299..13827471 188..16 865 100 Minus
3R 32079331 3R 7363540..7363592 72..20 175 88.7 Minus
Blast to na_te.dros performed on 2014-11-26 15:16:28 has no hits.

BS22029.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-01-25 17:17:18 Download gff for BS22029.complete
Subject Subject Range Query Range Percent Splice Strand
Mst87F-RA 151..321 17..187 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 23:50:38 Download gff for BS22029.complete
Subject Subject Range Query Range Percent Splice Strand
Mst87F-RA 151..321 17..187 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:10:03 Download gff for BS22029.complete
Subject Subject Range Query Range Percent Splice Strand
Mst87F-RA 127..297 17..187 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 16:10:03 Download gff for BS22029.complete
Subject Subject Range Query Range Percent Splice Strand
3R 13827300..13827470 17..187 100   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 23:50:38 Download gff for BS22029.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3R 9653022..9653192 17..187 100   Minus

BS22029.pep Sequence

Translation from 16 to 186

> BS22029.pep
MCCGPCGPCCGPCCGPCCGPCGPCGGGCGPCYGPNVCGPCYACGPCGGCY
CGYPCC*

BS22029.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 01:08:28
Subject Length Description Subject Range Query Range Score Percent Strand
Mst87F-PB 56 CG17956-PB 1..56 1..56 409 100 Plus
Mst87F-PA 56 CG17956-PA 1..56 1..56 409 100 Plus
Mst84Dd-PA 72 CG17935-PA 9..58 2..52 257 79.2 Plus
Mst84Dc-PB 55 CG17945-PB 1..55 1..51 225 68.4 Plus
Mst84Dc-PA 55 CG17945-PA 1..55 1..51 225 68.4 Plus
Mst84Dd-PA 72 CG17935-PA 32..71 2..39 147 63.4 Plus
Mst84Dd-PA 72 CG17935-PA 3..43 10..55 146 64.6 Plus