BS22029.complete Sequence
203 bp assembled on 2011-01-25
GenBank Submission: KX805167
> BS22029.complete
GAAGTTATCAGTCGACATGTGCTGCGGACCCTGTGGACCCTGCTGCGGAC
CTTGCTGCGGACCCTGCTGTGGTCCATGCGGACCATGCGGAGGAGGATGT
GGACCCTGCTATGGACCGAATGTCTGCGGACCATGCTATGCCTGTGGACC
CTGTGGCGGCTGCTATTGTGGATACCCTTGCTGCTAGAAGCTTTCTAGAC
CAT
BS22029.complete Blast Records
Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-26 15:16:29
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Mst87F-RB | 171 | CG17956-PB | 1..171 | 17..187 | 855 | 100 | Plus |
Mst87F-RA | 171 | CG17956-PA | 1..171 | 17..187 | 855 | 100 | Plus |
Mst84Dd-RA | 219 | CG17935-PA | 25..77 | 20..72 | 175 | 88.7 | Plus |
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:16:31
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Mst87F-RB | 515 | CG17956-RB | 195..367 | 16..188 | 865 | 100 | Plus |
Mst87F-RA | 446 | CG17956-RA | 126..298 | 16..188 | 865 | 100 | Plus |
Mst84Dd-RA | 415 | CG17935-RA | 130..182 | 20..72 | 175 | 88.7 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:16:27
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
3R | 32079331 | 3R | 13827299..13827471 | 188..16 | 865 | 100 | Minus |
3R | 32079331 | 3R | 7363540..7363592 | 72..20 | 175 | 88.7 | Minus |
Blast to na_te.dros performed on 2014-11-26 15:16:28 has no hits.
BS22029.complete Sim4 Records
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-01-25 17:17:18 Download gff for
BS22029.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Mst87F-RA | 151..321 | 17..187 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 23:50:38 Download gff for
BS22029.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Mst87F-RA | 151..321 | 17..187 | 100 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:10:03 Download gff for
BS22029.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Mst87F-RA | 127..297 | 17..187 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 16:10:03 Download gff for
BS22029.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3R | 13827300..13827470 | 17..187 | 100 | | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 23:50:38 Download gff for
BS22029.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_3R | 9653022..9653192 | 17..187 | 100 | | Minus |
BS22029.pep Sequence
Translation from 16 to 186
> BS22029.pep
MCCGPCGPCCGPCCGPCCGPCGPCGGGCGPCYGPNVCGPCYACGPCGGCY
CGYPCC*
BS22029.pep Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 01:08:28
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Mst87F-PB | 56 | CG17956-PB | 1..56 | 1..56 | 409 | 100 | Plus |
Mst87F-PA | 56 | CG17956-PA | 1..56 | 1..56 | 409 | 100 | Plus |
Mst84Dd-PA | 72 | CG17935-PA | 9..58 | 2..52 | 257 | 79.2 | Plus |
Mst84Dc-PB | 55 | CG17945-PB | 1..55 | 1..51 | 225 | 68.4 | Plus |
Mst84Dc-PA | 55 | CG17945-PA | 1..55 | 1..51 | 225 | 68.4 | Plus |
Mst84Dd-PA | 72 | CG17935-PA | 32..71 | 2..39 | 147 | 63.4 | Plus |
Mst84Dd-PA | 72 | CG17935-PA | 3..43 | 10..55 | 146 | 64.6 | Plus |