Clone BS22943 Report

Search the DGRC for BS22943

Clone and Library Details

Library:BS
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with native stop reading frames
Original Plate Number:229
Well:43
Vector:pDNR-Dual
Associated Gene/TranscriptMst84Db-RA
Protein status:BS22943.pep: full length peptide match
Sequenced Size:276

Clone Sequence Records

BS22943.complete Sequence

276 bp assembled on 2011-02-02

GenBank Submission: KX801714

> BS22943.complete
GAAGTTATCAGTCGACATGTGTTGCGGACCCCTTGGATTCTGCGGACCCT
GTAGCCCGTGCGGCGGTCCTTGCGGACCTTGCGGACCCTGTGGTCCTTGC
GGTTCCTGCTGTAGTCCTTGTGGATCTTGCTGTGCGCCTTGCGGCCCTTG
CGGTCCTTGCGGTCCTTGCTGCGGGGGCTGTGGTCCATGCGGGCCTTGTG
GACCTTGCTGTGGACCTTGTAGGCCATATTGCGGGTGCTGAAAGCTTTCT
AGACCATTCGTTTGGCGCTTAAGAGG

BS22943.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-26 15:19:53
Subject Length Description Subject Range Query Range Score Percent Strand
Mst84Db-RA 225 CG17934-PA 1..225 17..241 1125 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:19:54
Subject Length Description Subject Range Query Range Score Percent Strand
Mst84Db-RA 415 CG17934-RA 69..295 16..242 1135 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:19:51
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 7365280..7365506 242..16 1135 100 Minus
Blast to na_te.dros performed on 2014-11-26 15:19:52 has no hits.

BS22943.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-09 09:37:49 Download gff for BS22943.complete
Subject Subject Range Query Range Percent Splice Strand
Mst84Db-RA 70..295 17..242 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 23:59:31 Download gff for BS22943.complete
Subject Subject Range Query Range Percent Splice Strand
Mst84Db-RA 70..295 17..242 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:39:02 Download gff for BS22943.complete
Subject Subject Range Query Range Percent Splice Strand
Mst84Db-RA 70..295 17..242 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 16:39:02 Download gff for BS22943.complete
Subject Subject Range Query Range Percent Splice Strand
3R 7365280..7365505 17..242 100   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 23:59:31 Download gff for BS22943.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3R 3191002..3191227 17..242 100   Minus

BS22943.pep Sequence

Translation from 16 to 240

> BS22943.pep
MCCGPLGFCGPCSPCGGPCGPCGPCGPCGSCCSPCGSCCAPCGPCGPCGP
CCGGCGPCGPCGPCCGPCRPYCGC*

BS22943.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-27 19:09:06
Subject Length Description Subject Range Query Range Score Percent Strand
Mst84Db-PA 74 CG17934-PA 1..74 1..74 529 100 Plus
Mst98Cb-PA 265 CG18396-PA 202..265 7..68 274 64.8 Plus
Mst84Dd-PA 72 CG17935-PA 3..58 9..66 265 71.7 Plus
Mst98Ca-PA 334 CG11719-PA 157..275 2..70 245 45.4 Plus
Mst98Ca-PA 334 CG11719-PA 204..323 3..73 237 43.8 Plus
Mst84Dd-PA 72 CG17935-PA 3..58 12..73 235 67.2 Plus
Mst84Da-PA 63 CG17946-PA 15..63 14..65 231 67.3 Plus
Mst98Ca-PA 334 CG11719-PA 247..334 3..68 229 50.6 Plus
Mst84Dd-PA 72 CG17935-PA 9..70 2..65 224 61.2 Plus
Mst98Ca-PA 334 CG11719-PA 158..222 22..73 170 47.1 Plus
Mst98Cb-PA 265 CG18396-PA 158..221 22..73 160 47.1 Plus