BS22943.complete Sequence
276 bp assembled on 2011-02-02
GenBank Submission: KX801714
> BS22943.complete
GAAGTTATCAGTCGACATGTGTTGCGGACCCCTTGGATTCTGCGGACCCT
GTAGCCCGTGCGGCGGTCCTTGCGGACCTTGCGGACCCTGTGGTCCTTGC
GGTTCCTGCTGTAGTCCTTGTGGATCTTGCTGTGCGCCTTGCGGCCCTTG
CGGTCCTTGCGGTCCTTGCTGCGGGGGCTGTGGTCCATGCGGGCCTTGTG
GACCTTGCTGTGGACCTTGTAGGCCATATTGCGGGTGCTGAAAGCTTTCT
AGACCATTCGTTTGGCGCTTAAGAGG
BS22943.complete Blast Records
Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-26 15:19:53
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Mst84Db-RA | 225 | CG17934-PA | 1..225 | 17..241 | 1125 | 100 | Plus |
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:19:54
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Mst84Db-RA | 415 | CG17934-RA | 69..295 | 16..242 | 1135 | 100 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:19:51
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
3R | 32079331 | 3R | 7365280..7365506 | 242..16 | 1135 | 100 | Minus |
Blast to na_te.dros performed on 2014-11-26 15:19:52 has no hits.
BS22943.complete Sim4 Records
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-09 09:37:49 Download gff for
BS22943.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Mst84Db-RA | 70..295 | 17..242 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 23:59:31 Download gff for
BS22943.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Mst84Db-RA | 70..295 | 17..242 | 100 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:39:02 Download gff for
BS22943.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Mst84Db-RA | 70..295 | 17..242 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 16:39:02 Download gff for
BS22943.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3R | 7365280..7365505 | 17..242 | 100 | | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 23:59:31 Download gff for
BS22943.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_3R | 3191002..3191227 | 17..242 | 100 | | Minus |
BS22943.pep Sequence
Translation from 16 to 240
> BS22943.pep
MCCGPLGFCGPCSPCGGPCGPCGPCGPCGSCCSPCGSCCAPCGPCGPCGP
CCGGCGPCGPCGPCCGPCRPYCGC*
BS22943.pep Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-27 19:09:06
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Mst84Db-PA | 74 | CG17934-PA | 1..74 | 1..74 | 529 | 100 | Plus |
Mst98Cb-PA | 265 | CG18396-PA | 202..265 | 7..68 | 274 | 64.8 | Plus |
Mst84Dd-PA | 72 | CG17935-PA | 3..58 | 9..66 | 265 | 71.7 | Plus |
Mst98Ca-PA | 334 | CG11719-PA | 157..275 | 2..70 | 245 | 45.4 | Plus |
Mst98Ca-PA | 334 | CG11719-PA | 204..323 | 3..73 | 237 | 43.8 | Plus |
Mst84Dd-PA | 72 | CG17935-PA | 3..58 | 12..73 | 235 | 67.2 | Plus |
Mst84Da-PA | 63 | CG17946-PA | 15..63 | 14..65 | 231 | 67.3 | Plus |
Mst98Ca-PA | 334 | CG11719-PA | 247..334 | 3..68 | 229 | 50.6 | Plus |
Mst84Dd-PA | 72 | CG17935-PA | 9..70 | 2..65 | 224 | 61.2 | Plus |
Mst98Ca-PA | 334 | CG11719-PA | 158..222 | 22..73 | 170 | 47.1 | Plus |
Mst98Cb-PA | 265 | CG18396-PA | 158..221 | 22..73 | 160 | 47.1 | Plus |