Clone BS23074 Report

Search the DGRC for BS23074

Clone and Library Details

Library:BS
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with native stop reading frames
Original Plate Number:230
Well:74
Vector:pDNR-Dual
Associated Gene/TranscriptPif2-RA
Protein status:BS23074.pep: full length peptide match
Sequenced Size:408

Clone Sequence Records

BS23074.complete Sequence

408 bp assembled on 2011-02-02

GenBank Submission: KX803994

> BS23074.complete
GAAGTTATCAGTCGACATGTGCAGCCCCTGCTGTGGATCCTGCTGCGGAC
CTTGCTGCTCCCCCTGCTGCAGCCCTTGTTGTCCACCGTGCTGCAATGAC
TGCTGCGGGTCCTGCTGCAGTCCGTGTTGCGGACCCTGTTGCAGCCCCTG
CTGCGGACCCTGCTGCAGCCCCTGCTGCAGTCCTTGCTGCACCCCCTGTT
GCACCCCTTGCTGCACGCCGTGCTGCAAGTGTTGCACACCCTGCTGCGTG
CCGTGTTGCACACCCTGCTGCACCCCCTGCTGCACTCCCTGTTGCACCCC
TTGCTGCAGTCCGTGCTGCGGTCCGTGCTGCAGCCCCTGCTGCTCTCCTT
GCGGAGGGTCAAAGTGCAAGTGAAAGCTTTCTAGACCATTCGTTTGGCGC
TCTAAATG

BS23074.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-26 22:04:37
Subject Length Description Subject Range Query Range Score Percent Strand
Pif2-RA 357 CG31483-PA 1..357 17..373 1785 100 Plus
Pif2-RA 357 CG31483-PA 95..171 276..352 190 83.1 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 22:04:38
Subject Length Description Subject Range Query Range Score Percent Strand
Pif2-RA 887 CG31483-RA 122..478 17..373 1785 100 Plus
Pif2-RA 887 CG31483-RA 216..292 276..352 190 83.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 22:04:35
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 6549218..6549574 17..373 1785 100 Plus
3R 32079331 3R 6549312..6549388 276..352 190 83.1 Plus
Blast to na_te.dros performed 2014-11-26 22:04:36
Subject Length Description Subject Range Query Range Score Percent Strand
Dmer\R1A3 3772 Dmer\R1A3 MERCR1A3 3772bp 648..736 277..368 200 71.7 Plus

BS23074.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-02-02 09:57:11 Download gff for BS23074.complete
Subject Subject Range Query Range Percent Splice Strand
Pif2-RA 122..478 17..373 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 03:45:52 Download gff for BS23074.complete
Subject Subject Range Query Range Percent Splice Strand
Pif2-RA 122..478 17..373 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 22:50:29 Download gff for BS23074.complete
Subject Subject Range Query Range Percent Splice Strand
Pif2-RA 122..478 17..373 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 22:50:29 Download gff for BS23074.complete
Subject Subject Range Query Range Percent Splice Strand
3R 6549218..6549574 17..373 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 03:45:52 Download gff for BS23074.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3R 2374940..2375296 17..373 100   Plus

BS23074.pep Sequence

Translation from 16 to 372

> BS23074.pep
MCSPCCGSCCGPCCSPCCSPCCPPCCNDCCGSCCSPCCGPCCSPCCGPCC
SPCCSPCCTPCCTPCCTPCCKCCTPCCVPCCTPCCTPCCTPCCTPCCSPC
CGPCCSPCCSPCGGSKCK*

BS23074.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 01:06:28
Subject Length Description Subject Range Query Range Score Percent Strand
Pif2-PA 118 CG31483-PA 1..118 1..118 864 100 Plus
Mst84Dd-PA 72 CG17935-PA 3..57 2..58 243 66.1 Plus
Mst84Dd-PA 72 CG17935-PA 7..57 11..62 241 68.5 Plus
Mst84Dd-PA 72 CG17935-PA 3..57 34..89 237 65.5 Plus
Mst84Dd-PA 72 CG17935-PA 7..57 31..81 237 67.9 Plus
Mst84Dd-PA 72 CG17935-PA 3..57 14..77 232 60.9 Plus
Mst98Ca-PA 334 CG11719-PA 172..320 2..113 227 40.7 Plus
Mst84Dd-PA 72 CG17935-PA 8..59 64..115 224 64.8 Plus
Mst84Dd-PA 72 CG17935-PA 3..57 42..109 214 55.7 Plus
Mst84Db-PA 74 CG17934-PA 2..73 37..113 207 50.6 Plus
Mst98Ca-PA 334 CG11719-PA 210..331 2..115 198 40.6 Plus
Mst84Dc-PB 55 CG17945-PB 1..53 1..49 193 61.8 Plus
Mst98Ca-PA 334 CG11719-PA 169..304 19..112 188 37.5 Plus
Mst84Db-PA 74 CG17934-PA 12..73 2..47 174 55.6 Plus
Mst98Ca-PA 334 CG11719-PA 157..285 17..113 168 37.6 Plus
Mst84Db-PA 74 CG17934-PA 2..54 65..114 136 51.8 Plus
Mst84Dd-PA 72 CG17935-PA 8..33 91..117 132 70.4 Plus