Clone BS23330 Report

Search the DGRC for BS23330

Clone and Library Details

Library:BS
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with native stop reading frames
Original Plate Number:233
Well:30
Vector:pDNR-Dual
Associated Gene/TranscriptCG12546-RA
Protein status:BS23330.pep: full length peptide match
Sequenced Size:386

Clone Sequence Records

BS23330.complete Sequence

386 bp assembled on 2011-01-25

GenBank Submission: KX803870

> BS23330.complete
GAAGTTATCAGTCGACATGCGCTTCTCGATCGTAATTGTTCTTTCCGTCC
TAGGATGCCTCCTGCTTAGCCAGGAGGGCAGTAGCAGCACATCTACATCC
TCGACGACGACCACAACCACCGACTCCTCTGCCACCACTACCACGGCTTC
GTCCGCCACCACTACCACCACTGCCTCTTCCGCATCCACCACGACCACTG
CCTCCTCCTCATCCTCTTCCTCTGCGGAGGCCAGGAGGCGCAGGCGCGCC
CGTCGCCGTCGTCTGGCGCGTGAGAGGCAACGAAGGGAGCGCAGAAGGCA
GCGCAGGACTCAGAGGCTGCGCCAGCAACTGGAGAATCAACGTCGACAGA
TCAACCAGCTGAGCGGATGAAAGCTTTCTAGACCAT

BS23330.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-26 16:31:22
Subject Length Description Subject Range Query Range Score Percent Strand
CG14452-RA 354 CG14452-PA 1..354 17..370 1770 100 Plus
CG12546-RA 354 CG12546-PA 1..354 17..370 1770 100 Plus
CG32453-RB 363 CG32453-PB 55..258 71..274 665 90.3 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:31:23
Subject Length Description Subject Range Query Range Score Percent Strand
CG14452-RA 483 CG14452-RA 17..372 16..371 1780 100 Plus
CG12546-RA 489 CG12546-RA 23..378 16..371 1780 100 Plus
CG32453-RB 741 CG32453-RB 72..275 71..274 665 90.3 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:31:20
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 22693435..22693790 371..16 1780 100 Minus
3L 28110227 3L 22695969..22696324 16..371 1780 100 Plus
3L 28110227 3L 22692255..22692458 274..71 665 90.3 Minus
3L 28110227 3L 22697301..22697504 71..274 665 90.3 Plus
Blast to na_te.dros performed on 2014-11-26 16:31:21 has no hits.

BS23330.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-01-25 17:15:47 Download gff for BS23330.complete
Subject Subject Range Query Range Percent Splice Strand
CG12546-RA 17..369 17..369 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 23:58:59 Download gff for BS23330.complete
Subject Subject Range Query Range Percent Splice Strand
CG12546-RA 24..376 17..369 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:06:17 Download gff for BS23330.complete
Subject Subject Range Query Range Percent Splice Strand
CG12546-RA 24..376 17..369 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:06:17 Download gff for BS23330.complete
Subject Subject Range Query Range Percent Splice Strand
3L 22695970..22696322 17..369 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 23:58:59 Download gff for BS23330.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3L 22689070..22689422 17..369 100   Plus

BS23330.pep Sequence

Translation from 16 to 369

> BS23330.pep
MRFSIVIVLSVLGCLLLSQEGSSSTSTSSTTTTTTDSSATTTTASSATTT
TTASSASTTTTASSSSSSSAEARRRRRARRRRLARERQRRERRRQRRTQR
LRQQLENQRRQINQLSG*

BS23330.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-27 18:48:39
Subject Length Description Subject Range Query Range Score Percent Strand
CG14452-PA 117 CG14452-PA 1..117 1..117 547 100 Plus
CG12546-PA 117 CG12546-PA 1..117 1..117 547 100 Plus
CG32453-PB 120 CG32453-PB 1..120 1..117 408 74.2 Plus
CG32453-PA 120 CG32453-PA 1..120 1..117 408 74.2 Plus
CG14454-PB 120 CG14454-PB 1..120 1..117 408 74.2 Plus