Clone BS23886 Report

Search the DGRC for BS23886

Clone and Library Details

Library:BS
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with native stop reading frames
Original Plate Number:238
Well:86
Vector:pDNR-Dual
Associated Gene/TranscriptCG17931-RA
Protein status:BS23886.pep: full length peptide match
Sequenced Size:215

Clone Sequence Records

BS23886.complete Sequence

215 bp assembled on 2011-01-27

GenBank Submission: KX804430

> BS23886.complete
GAAGTTATCAGTCGACATGACACGCGGCAACCAACGAGACCTGGCCCGCC
AGAAGAACCAGAAGAAGCAGGCGGATTTGACCAAGGGAAAGCGAACCGAT
AACCTCACCGTGGAGCAAAGGAAGGCCAGGGACGCTGAGTTAATGCGGGA
GAAGCAGAAAAAAAAGGAAGAGGCCGCTGCGGCGGGCACAAGCAAATAGA
AGCTTTCTAGACCAT

BS23886.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-26 16:01:19
Subject Length Description Subject Range Query Range Score Percent Strand
CG17931-RD 183 CG17931-PD 1..183 17..199 915 100 Plus
CG17931-RC 183 CG17931-PC 1..183 17..199 915 100 Plus
CG17931-RA 183 CG17931-PA 1..183 17..199 915 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:01:20
Subject Length Description Subject Range Query Range Score Percent Strand
CG17931-RD 1367 CG17931-RD 178..360 17..199 915 100 Plus
CG17931-RC 1081 CG17931-RC 178..360 17..199 915 100 Plus
CG17931-RA 762 CG17931-RA 178..360 17..199 915 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:01:17
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 16358682..16358788 130..24 535 100 Minus
3R 32079331 3R 16358542..16358614 199..127 365 100 Minus
Blast to na_te.dros performed on 2014-11-26 16:01:18 has no hits.

BS23886.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-01-28 16:05:27 Download gff for BS23886.complete
Subject Subject Range Query Range Percent Splice Strand
CG17931-RA 176..352 17..193 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:50:21 Download gff for BS23886.complete
Subject Subject Range Query Range Percent Splice Strand
CG17931-RA 178..354 17..193 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:09:24 Download gff for BS23886.complete
Subject Subject Range Query Range Percent Splice Strand
CG17931-RA 178..354 17..193 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:09:24 Download gff for BS23886.complete
Subject Subject Range Query Range Percent Splice Strand
3R 16358548..16358611 130..193 100 <- Minus
3R 16358683..16358792 17..129 96   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:50:21 Download gff for BS23886.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3R 12184270..12184333 130..193 100 <- Minus
arm_3R 12184405..12184514 17..129 96   Minus

BS23886.pep Sequence

Translation from 16 to 198

> BS23886.pep
MTRGNQRDLARQKNQKKQADLTKGKRTDNLTVEQRKARDAELMREKQKKK
EEAAAAGTSK*

BS23886.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-27 18:52:47
Subject Length Description Subject Range Query Range Score Percent Strand
CG17931-PD 60 CG17931-PD 1..60 1..60 296 100 Plus
CG17931-PC 60 CG17931-PC 1..60 1..60 296 100 Plus
CG17931-PA 60 CG17931-PA 1..60 1..60 296 100 Plus