Clone BS25064 Report

Search the DGRC for BS25064

Clone and Library Details

Library:BS
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with native stop reading frames
Original Plate Number:250
Well:64
Vector:pDNR-Dual
Associated Gene/TranscriptCG31639-RA
Protein status:BS25064.pep: full length peptide match
Sequenced Size:209

Clone Sequence Records

BS25064.complete Sequence

209 bp assembled on 2011-06-27

GenBank Submission: KX804057

> BS25064.complete
GAAGTTATCAGTCGACATGTGCGGTTATGGATGCGGTCCCTATGGCTATG
GACCTTCGGGTCCTTGCGGACCATGGTGCGGACCCTGGTGTAGTCCTTGT
GCCCTCTCGCTAGGACCCTATTCCTGCTGTGGACCCAGTGGATGCGGACC
AAGCGGCCCAGCGTGTTGGCCGTATGGCTTGTACACCTGCTAGAAGCTTT
CTAGACCAT

BS25064.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-26 15:55:32
Subject Length Description Subject Range Query Range Score Percent Strand
CG31639-RB 177 CG31639-PB 1..177 17..193 885 100 Plus
CG31639-RA 177 CG31639-PA 1..177 17..193 885 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:55:33
Subject Length Description Subject Range Query Range Score Percent Strand
CG31639-RB 633 CG31639-RB 214..390 17..193 885 100 Plus
CG31639-RA 487 CG31639-RA 132..308 17..193 885 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:55:30
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 6154699..6154875 193..17 885 100 Minus
Blast to na_te.dros performed on 2014-11-26 15:55:31 has no hits.

BS25064.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-06-27 10:24:26 Download gff for BS25064.complete
Subject Subject Range Query Range Percent Splice Strand
CG31639-RB 161..337 17..193 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 00:06:14 Download gff for BS25064.complete
Subject Subject Range Query Range Percent Splice Strand
CG31639-RA 148..324 17..193 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:51:55 Download gff for BS25064.complete
Subject Subject Range Query Range Percent Splice Strand
CG31639-RA 132..308 17..193 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 16:51:55 Download gff for BS25064.complete
Subject Subject Range Query Range Percent Splice Strand
2L 6154699..6154875 17..193 100   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 00:06:14 Download gff for BS25064.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2L 6154699..6154875 17..193 100   Minus

BS25064.pep Sequence

Translation from 16 to 192

> BS25064.pep
MCGYGCGPYGYGPSGPCGPWCGPWCSPCALSLGPYSCCGPSGCGPSGPAC
WPYGLYTC*

BS25064.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 06:39:42
Subject Length Description Subject Range Query Range Score Percent Strand
CG31639-PB 58 CG31639-PB 1..58 1..58 389 100 Plus
CG31639-PA 58 CG31639-PA 1..58 1..58 389 100 Plus
Mst84Dd-PA 72 CG17935-PA 2..51 5..54 148 58.2 Plus
Mst98Cb-PA 265 CG18396-PA 207..257 2..58 146 57.6 Plus
Mst84Dc-PB 55 CG17945-PB 6..47 2..54 139 54.7 Plus