Clone BS28512 Report

Search the DGRC for BS28512

Clone and Library Details

Library:BS
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with native stop reading frames
Original Plate Number:285
Well:12
Vector:pDNR-Dual
Associated Gene/TranscriptCG43069-RA
Protein status:BS28512.pep: full length peptide match
Sequenced Size:272

Clone Sequence Records

BS28512.complete Sequence

272 bp assembled on 2012-03-26

GenBank Submission: KX801806

> BS28512.complete
GAAGTTATCAGTCGACATGGCCAATCAAAGCAAAACCATTTGGCTTCTAT
CCTCAAATCTACCTAAACTGCGGTGCCATGTGAGAACGGATCAACCTTTG
GCCGCACTTCTTAGGCAAAAATATGCCCAGGCATTTGGAGTTGCTACTGA
GTCTCTGATCCTGGCCTTCGATGGTGAGAAAATCCAGGAGGAGGACACAT
TTGACTCCTTGGCCATGGAGGATAATGACATCGTCGATGTTGTAGAAGAA
TGTTAGAAGCTTTCTAGACCAT

BS28512.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 04:07:03
Subject Length Description Subject Range Query Range Score Percent Strand
CG43069-RA 240 CG43069-PA 1..240 17..256 1200 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 04:07:04
Subject Length Description Subject Range Query Range Score Percent Strand
CG43069-RA 416 CG43069-RA 25..264 17..256 1200 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 04:07:02
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 18862886..18863125 17..256 1200 100 Plus
Blast to na_te.dros performed on 2014-11-28 04:07:02 has no hits.

BS28512.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2012-03-26 11:12:59 Download gff for BS28512.complete
Subject Subject Range Query Range Percent Splice Strand
CG43069-RA 25..264 17..256 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:10:15 Download gff for BS28512.complete
Subject Subject Range Query Range Percent Splice Strand
CG43069-RA 25..264 17..256 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 05:20:03 Download gff for BS28512.complete
Subject Subject Range Query Range Percent Splice Strand
CG43069-RA 25..264 17..256 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 05:20:03 Download gff for BS28512.complete
Subject Subject Range Query Range Percent Splice Strand
2R 18862886..18863125 17..256 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:10:15 Download gff for BS28512.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2R 14750391..14750630 17..256 100   Plus

BS28512.pep Sequence

Translation from 16 to 255

> BS28512.pep
MANQSKTIWLLSSNLPKLRCHVRTDQPLAALLRQKYAQAFGVATESLILA
FDGEKIQEEDTFDSLAMEDNDIVDVVEEC*

BS28512.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 07:59:42
Subject Length Description Subject Range Query Range Score Percent Strand
CG43069-PA 79 CG43069-PA 1..79 1..79 401 100 Plus