Clone BS28517 Report

Search the DGRC for BS28517

Clone and Library Details

Library:BS
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with native stop reading frames
Original Plate Number:285
Well:17
Vector:pDNR-Dual
Associated Gene/TranscriptCG15126-RA
Protein status:BS28517.pep: full length peptide match
Sequenced Size:194

Clone Sequence Records

BS28517.complete Sequence

194 bp assembled on 2012-03-26

GenBank Submission: KX803034

> BS28517.complete
GAAGTTATCAGTCGACATGCCACCACCACACGGAGGACCCGGAGGCCATG
GACATGGAGGACCGCATCATGGCGGACCCCCGCATCATGGAGGCCACCAT
GGACCGCCACATCACCATGGACCGCCCCATCATCACCACGGACCTCGTCC
CTGCTGCCTTTGCTGCACAATTTCATAAAAGCTTTCTAGACCAT

BS28517.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 04:10:51
Subject Length Description Subject Range Query Range Score Percent Strand
CG15126-RA 162 CG15126-PA 1..162 17..178 810 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 04:10:52
Subject Length Description Subject Range Query Range Score Percent Strand
CG15126-RA 281 CG15126-RA 48..209 17..178 810 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 04:10:49
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 19690845..19691006 17..178 810 100 Plus
Blast to na_te.dros performed on 2014-11-28 04:10:50 has no hits.

BS28517.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2012-03-26 11:13:40 Download gff for BS28517.complete
Subject Subject Range Query Range Percent Splice Strand
CG15126-RA 1..160 17..176 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:12:16 Download gff for BS28517.complete
Subject Subject Range Query Range Percent Splice Strand
CG15126-RA 48..207 17..176 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 05:21:43 Download gff for BS28517.complete
Subject Subject Range Query Range Percent Splice Strand
CG15126-RA 48..207 17..176 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 05:21:43 Download gff for BS28517.complete
Subject Subject Range Query Range Percent Splice Strand
2R 19690845..19691004 17..176 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:12:16 Download gff for BS28517.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2R 15578350..15578509 17..176 100   Plus

BS28517.pep Sequence

Translation from 16 to 177

> BS28517.pep
MPPPHGGPGGHGHGGPHHGGPPHHGGHHGPPHHHGPPHHHHGPRPCCLCC
TIS*

BS28517.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 08:04:49
Subject Length Description Subject Range Query Range Score Percent Strand
CG15126-PA 53 CG15126-PA 1..53 1..53 366 100 Plus
CG43349-PB 70 CG43349-PB 15..60 3..43 172 70.2 Plus
CG43349-PA 70 CG43349-PA 15..60 3..43 172 70.2 Plus
CG43349-PB 70 CG43349-PB 1..50 1..43 168 64.7 Plus
CG43349-PA 70 CG43349-PA 1..50 1..43 168 64.7 Plus
CG43349-PB 70 CG43349-PB 20..63 3..39 156 63.6 Plus
CG43349-PA 70 CG43349-PA 20..63 3..39 156 63.6 Plus
CG43349-PB 70 CG43349-PB 25..68 3..39 147 61.4 Plus
CG43349-PA 70 CG43349-PA 25..68 3..39 147 61.4 Plus
CG13482-PA 102 CG13482-PA 20..71 9..45 132 51.9 Plus