Clone BS31188 Report

Search the DGRC for BS31188

Clone and Library Details

Library:BS
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with native stop reading frames
Original Plate Number:311
Well:88
Vector:pDNR-Dual
Associated Gene/TranscriptCG12853-RA
Protein status:BS31188.pep: full length peptide match
Sequenced Size:197

Clone Sequence Records

BS31188.complete Sequence

197 bp assembled on 2012-07-13

GenBank Submission: KX801302

> BS31188.complete
GAAGTTATCAGTCGACATGCCGGCAAAAAAGGAATCAAACAAGGGTGCTA
AGAAAGGAGCTGCCGCTCCAGCTGGTGCCAAGCCGACCGCCGATCCTGTG
ACTTCCGAATCGAACAACGCAGCGGAACCAGCCGCCAAGGAAGCCAAGGG
TTCCAAGAAGGGCAAAGGCAAAAAGAAGTAAAAGCTTTCTAGACCAT

BS31188.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 11:44:34
Subject Length Description Subject Range Query Range Score Percent Strand
CG12853-RA 165 CG12853-PA 1..165 17..181 825 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 11:44:35
Subject Length Description Subject Range Query Range Score Percent Strand
CG12853-RA 329 CG12853-RA 84..248 17..181 825 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 11:44:32
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 14933668..14933832 17..181 825 100 Plus
Blast to na_te.dros performed on 2014-11-28 11:44:33 has no hits.

BS31188.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2012-07-13 13:56:29 Download gff for BS31188.complete
Subject Subject Range Query Range Percent Splice Strand
CG12853-RA 84..246 17..179 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:31:17 Download gff for BS31188.complete
Subject Subject Range Query Range Percent Splice Strand
CG12853-RA 84..246 17..179 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 12:50:25 Download gff for BS31188.complete
Subject Subject Range Query Range Percent Splice Strand
CG12853-RA 84..246 17..179 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 12:50:25 Download gff for BS31188.complete
Subject Subject Range Query Range Percent Splice Strand
2R 14933668..14933830 17..179 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:31:17 Download gff for BS31188.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2R 10821173..10821335 17..179 100   Plus

BS31188.pep Sequence

Translation from 16 to 180

> BS31188.pep
MPAKKESNKGAKKGAAAPAGAKPTADPVTSESNNAAEPAAKEAKGSKKGK
GKKK*

BS31188.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 09:09:19
Subject Length Description Subject Range Query Range Score Percent Strand
CG12853-PA 54 CG12853-PA 1..54 1..54 272 100 Plus