BS31188.complete Sequence
197 bp assembled on 2012-07-13
GenBank Submission: KX801302
> BS31188.complete
GAAGTTATCAGTCGACATGCCGGCAAAAAAGGAATCAAACAAGGGTGCTA
AGAAAGGAGCTGCCGCTCCAGCTGGTGCCAAGCCGACCGCCGATCCTGTG
ACTTCCGAATCGAACAACGCAGCGGAACCAGCCGCCAAGGAAGCCAAGGG
TTCCAAGAAGGGCAAAGGCAAAAAGAAGTAAAAGCTTTCTAGACCAT
BS31188.complete Blast Records
Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 11:44:34
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG12853-RA | 165 | CG12853-PA | 1..165 | 17..181 | 825 | 100 | Plus |
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 11:44:35
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG12853-RA | 329 | CG12853-RA | 84..248 | 17..181 | 825 | 100 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 11:44:32
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
2R | 25286936 | 2R | 14933668..14933832 | 17..181 | 825 | 100 | Plus |
Blast to na_te.dros performed on 2014-11-28 11:44:33 has no hits.
BS31188.complete Sim4 Records
Sim4 to dmel-all-transcript-r5.32.fasta performed 2012-07-13 13:56:29 Download gff for
BS31188.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG12853-RA | 84..246 | 17..179 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:31:17 Download gff for
BS31188.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG12853-RA | 84..246 | 17..179 | 100 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 12:50:25 Download gff for
BS31188.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
CG12853-RA | 84..246 | 17..179 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 12:50:25 Download gff for
BS31188.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2R | 14933668..14933830 | 17..179 | 100 | | Plus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:31:17 Download gff for
BS31188.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_2R | 10821173..10821335 | 17..179 | 100 | | Plus |
BS31188.pep Sequence
Translation from 16 to 180
> BS31188.pep
MPAKKESNKGAKKGAAAPAGAKPTADPVTSESNNAAEPAAKEAKGSKKGK
GKKK*
BS31188.pep Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 09:09:19
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
CG12853-PA | 54 | CG12853-PA | 1..54 | 1..54 | 272 | 100 | Plus |