BS32103.complete Sequence
209 bp assembled on 2013-04-19
GenBank Submission: KX802048
> BS32103.complete
GAAGTTATCAGTCGACATGGCAATAACTGCAGCAGCAGCAGCAGCAGCGG
CGGCAAACAAGCTAAACAAGTATTGCTGTGCCGAGAAGCAGCAGCAGCAG
CAGCAGCAGCAACAGCAACAGCAGCCGCAGCAGCAACAGCAACATCAGCA
GATAAAAGGCAGACAAAAGGCACGAGATGTGAGAGACGTCTAGAAGCTTT
CTAGACCAT
BS32103.complete Blast Records
Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 13:18:22
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Tango8-RA | 177 | CG14503-PA | 1..177 | 17..193 | 885 | 100 | Plus |
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 13:18:23
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Tango8-RA | 177 | CG14503-RA | 1..177 | 17..193 | 885 | 100 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 13:18:21
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
2R | 25286936 | 2R | 18311822..18311998 | 17..193 | 885 | 100 | Plus |
Blast to na_te.dros performed on 2014-11-28 13:18:21 has no hits.
BS32103.complete Sim4 Records
Sim4 to dmel-all-transcript-r5.32.fasta performed 2013-04-19 17:05:36 Download gff for
BS32103.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Tango8-RA | 1..177 | 17..193 | 100 | | Plus |
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:03:01 Download gff for
BS32103.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Tango8-RA | 1..177 | 17..193 | 100 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 14:25:46 Download gff for
BS32103.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Tango8-RA | 1..177 | 17..193 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 14:25:46 Download gff for
BS32103.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2R | 18311822..18311998 | 17..193 | 100 | | Plus |
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:03:01 Download gff for
BS32103.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_2R | 14199327..14199503 | 17..193 | 100 | | Plus |
BS32103.pep Sequence
Translation from 16 to 192
> BS32103.pep
MAITAAAAAAAAANKLNKYCCAEKQQQQQQQQQQQQPQQQQQHQQIKGRQ
KARDVRDV*
BS32103.pep Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 09:11:09
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Tango8-PA | 58 | CG14503-PA | 1..58 | 1..58 | 293 | 100 | Plus |