Clone BS32103 Report

Search the DGRC for BS32103

Clone and Library Details

Library:BS
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with native stop reading frames
Original Plate Number:321
Well:3
Vector:pDNR-Dual
Associated Gene/TranscriptTango8-RA
Protein status:BS32103.pep: full length peptide match
Sequenced Size:209

Clone Sequence Records

BS32103.complete Sequence

209 bp assembled on 2013-04-19

GenBank Submission: KX802048

> BS32103.complete
GAAGTTATCAGTCGACATGGCAATAACTGCAGCAGCAGCAGCAGCAGCGG
CGGCAAACAAGCTAAACAAGTATTGCTGTGCCGAGAAGCAGCAGCAGCAG
CAGCAGCAGCAACAGCAACAGCAGCCGCAGCAGCAACAGCAACATCAGCA
GATAAAAGGCAGACAAAAGGCACGAGATGTGAGAGACGTCTAGAAGCTTT
CTAGACCAT

BS32103.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 13:18:22
Subject Length Description Subject Range Query Range Score Percent Strand
Tango8-RA 177 CG14503-PA 1..177 17..193 885 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 13:18:23
Subject Length Description Subject Range Query Range Score Percent Strand
Tango8-RA 177 CG14503-RA 1..177 17..193 885 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 13:18:21
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 18311822..18311998 17..193 885 100 Plus
Blast to na_te.dros performed on 2014-11-28 13:18:21 has no hits.

BS32103.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.32.fasta performed 2013-04-19 17:05:36 Download gff for BS32103.complete
Subject Subject Range Query Range Percent Splice Strand
Tango8-RA 1..177 17..193 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:03:01 Download gff for BS32103.complete
Subject Subject Range Query Range Percent Splice Strand
Tango8-RA 1..177 17..193 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 14:25:46 Download gff for BS32103.complete
Subject Subject Range Query Range Percent Splice Strand
Tango8-RA 1..177 17..193 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 14:25:46 Download gff for BS32103.complete
Subject Subject Range Query Range Percent Splice Strand
2R 18311822..18311998 17..193 100   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:03:01 Download gff for BS32103.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2R 14199327..14199503 17..193 100   Plus

BS32103.pep Sequence

Translation from 16 to 192

> BS32103.pep
MAITAAAAAAAAANKLNKYCCAEKQQQQQQQQQQQQPQQQQQHQQIKGRQ
KARDVRDV*

BS32103.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 09:11:09
Subject Length Description Subject Range Query Range Score Percent Strand
Tango8-PA 58 CG14503-PA 1..58 1..58 293 100 Plus