BS32987.complete Sequence
155 bp assembled on 2014-01-22
GenBank Submission: KX806313
> BS32987.complete
GAAGTTATCAGTCGACATGCCTTGCCCATGCGGAAGCGGATGCAAATGCG
CCAGCCAGGCCACCAAGGGATCCTGCAACTGCGGATCTGACTGCAAGTGC
GGCGGCGACAAGAAATCCGCCTGCGGCTGCTCCGAGTGAAAGCTTTCTAG
ACCAT
BS32987.complete Blast Records
Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 14:47:25
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
MtnA-RB | 123 | CG9470-PB | 1..123 | 17..139 | 615 | 100 | Plus |
MtnA-RA | 123 | CG9470-PA | 1..123 | 17..139 | 615 | 100 | Plus |
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 14:47:26
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
MtnA-RB | 700 | CG9470-RB | 126..248 | 17..139 | 615 | 100 | Plus |
MtnA-RA | 329 | CG9470-RA | 126..248 | 17..139 | 615 | 100 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 14:47:24
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
3R | 32079331 | 3R | 9783859..9783960 | 139..38 | 510 | 100 | Minus |
Blast to na_te.dros performed on 2014-11-28 14:47:24 has no hits.
BS32987.complete Sim4 Records
Sim4 to dmel-all-transcript-r5.52.fasta performed 2014-01-22 13:05:09 Download gff for
BS32987.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
MtnA-RA | 126..247 | 17..138 | 100 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 15:23:03 Download gff for
BS32987.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
MtnA-RA | 126..247 | 17..138 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 15:23:03 Download gff for
BS32987.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
3R | 9783860..9783959 | 39..138 | 100 | <- | Minus |
3R | 9784224..9784245 | 17..38 | 100 | | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2014-01-22 13:05:09 Download gff for
BS32987.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_3R | 5609582..5609681 | 39..138 | 100 | <- | Minus |
arm_3R | 5609946..5609967 | 17..38 | 100 | | Minus |
BS32987.pep Sequence
Translation from 16 to 138
> BS32987.pep
MPCPCGSGCKCASQATKGSCNCGSDCKCGGDKKSACGCSE*
BS32987.pep Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 09:52:21
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
MtnA-PB | 40 | CG9470-PB | 1..40 | 1..40 | 245 | 100 | Plus |
MtnA-PA | 40 | CG9470-PA | 1..40 | 1..40 | 245 | 100 | Plus |