Clone BS32987 Report

Search the DGRC for BS32987

Clone and Library Details

Library:BS
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with native stop reading frames
Original Plate Number:329
Well:87
Vector:pDNR-Dual
Associated Gene/TranscriptMtnA-RA
Protein status:BS32987.pep: full length peptide match
Sequenced Size:155

Clone Sequence Records

BS32987.complete Sequence

155 bp assembled on 2014-01-22

GenBank Submission: KX806313

> BS32987.complete
GAAGTTATCAGTCGACATGCCTTGCCCATGCGGAAGCGGATGCAAATGCG
CCAGCCAGGCCACCAAGGGATCCTGCAACTGCGGATCTGACTGCAAGTGC
GGCGGCGACAAGAAATCCGCCTGCGGCTGCTCCGAGTGAAAGCTTTCTAG
ACCAT

BS32987.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 14:47:25
Subject Length Description Subject Range Query Range Score Percent Strand
MtnA-RB 123 CG9470-PB 1..123 17..139 615 100 Plus
MtnA-RA 123 CG9470-PA 1..123 17..139 615 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 14:47:26
Subject Length Description Subject Range Query Range Score Percent Strand
MtnA-RB 700 CG9470-RB 126..248 17..139 615 100 Plus
MtnA-RA 329 CG9470-RA 126..248 17..139 615 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 14:47:24
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 9783859..9783960 139..38 510 100 Minus
Blast to na_te.dros performed on 2014-11-28 14:47:24 has no hits.

BS32987.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.52.fasta performed 2014-01-22 13:05:09 Download gff for BS32987.complete
Subject Subject Range Query Range Percent Splice Strand
MtnA-RA 126..247 17..138 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 15:23:03 Download gff for BS32987.complete
Subject Subject Range Query Range Percent Splice Strand
MtnA-RA 126..247 17..138 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 15:23:03 Download gff for BS32987.complete
Subject Subject Range Query Range Percent Splice Strand
3R 9783860..9783959 39..138 100 <- Minus
3R 9784224..9784245 17..38 100   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2014-01-22 13:05:09 Download gff for BS32987.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3R 5609582..5609681 39..138 100 <- Minus
arm_3R 5609946..5609967 17..38 100   Minus

BS32987.pep Sequence

Translation from 16 to 138

> BS32987.pep
MPCPCGSGCKCASQATKGSCNCGSDCKCGGDKKSACGCSE*

BS32987.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 09:52:21
Subject Length Description Subject Range Query Range Score Percent Strand
MtnA-PB 40 CG9470-PB 1..40 1..40 245 100 Plus
MtnA-PA 40 CG9470-PA 1..40 1..40 245 100 Plus