Clone BS33082 Report

Search the DGRC for BS33082

Clone and Library Details

Library:BS
Tissue Source:D. melanogaster
Created by:Joe Carlson
Date Registered:2004-06-03
Comments:Infusion clones with native stop reading frames
Original Plate Number:330
Well:82
Vector:pDNR-Dual
Associated Gene/TranscriptSfp60F-RB
Protein status:BS33082.pep: gold
Sequenced Size:224

Clone Sequence Records

BS33082.complete Sequence

224 bp assembled on 2014-01-22

GenBank Submission: KX803593

> BS33082.complete
GAAGTTATCAGTCGACATGTCTCGCCTTTTTATTTTAGCACTTATTCTGT
CCATCCTAGCCGACAGTGCTTTTGGTAATATTGATGAGCTTTTACGAAGC
ATTGACAGGGCACTTGGTGGAGCCTTGGGAATAAATCCTAGTCTTGCAAG
GTCTGGATTTGGTATAAGAACACCCAGTAGCGAATTTTCGATTGGATATG
GTGGCTGAAAGCTTTCTAGACCAT

BS33082.complete Blast Records

Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 14:50:41
Subject Length Description Subject Range Query Range Score Percent Strand
Sfp60F-RB 192 CG42478-PB 1..192 17..208 960 100 Plus
Sfp60F-RA 249 CG42478-PA 58..249 17..208 960 100 Plus
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 14:50:43
Subject Length Description Subject Range Query Range Score Percent Strand
Sfp60F-RB 321 CG42478-RB 51..242 17..208 960 100 Plus
Sfp60F-RA 399 CG42478-RA 58..249 17..208 960 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 14:50:40
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 25172395..25172571 208..32 885 100 Minus
Blast to na_te.dros performed on 2014-11-28 14:50:41 has no hits.

BS33082.complete Sim4 Records

Sim4 to dmel-all-transcript-r5.52.fasta performed 2014-01-22 13:06:33 Download gff for BS33082.complete
Subject Subject Range Query Range Percent Splice Strand
Sfp60F-RA 58..248 17..207 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 15:24:33 Download gff for BS33082.complete
Subject Subject Range Query Range Percent Splice Strand
Sfp60F-RA 58..248 17..207 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 15:24:33 Download gff for BS33082.complete
Subject Subject Range Query Range Percent Splice Strand
2R 25172396..25172571 32..207 100 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2014-01-22 13:06:33 Download gff for BS33082.complete
Subject Subject Range Query Range Percent Splice Strand
arm_2R 21059919..21060094 32..207 100 <- Minus

BS33082.pep Sequence

Translation from 16 to 207

> BS33082.pep
MSRLFILALILSILADSAFGNIDELLRSIDRALGGALGINPSLARSGFGI
RTPSSEFSIGYGG*

BS33082.pep Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 09:53:58
Subject Length Description Subject Range Query Range Score Percent Strand
Sfp60F-PB 63 CG42478-PB 1..63 1..63 306 100 Plus
Sfp60F-PA 82 CG42478-PA 20..82 1..63 306 100 Plus