BS33082.complete Sequence
224 bp assembled on 2014-01-22
GenBank Submission: KX803593
> BS33082.complete
GAAGTTATCAGTCGACATGTCTCGCCTTTTTATTTTAGCACTTATTCTGT
CCATCCTAGCCGACAGTGCTTTTGGTAATATTGATGAGCTTTTACGAAGC
ATTGACAGGGCACTTGGTGGAGCCTTGGGAATAAATCCTAGTCTTGCAAG
GTCTGGATTTGGTATAAGAACACCCAGTAGCGAATTTTCGATTGGATATG
GTGGCTGAAAGCTTTCTAGACCAT
BS33082.complete Blast Records
Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-28 14:50:41
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Sfp60F-RB | 192 | CG42478-PB | 1..192 | 17..208 | 960 | 100 | Plus |
Sfp60F-RA | 249 | CG42478-PA | 58..249 | 17..208 | 960 | 100 | Plus |
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 14:50:43
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Sfp60F-RB | 321 | CG42478-RB | 51..242 | 17..208 | 960 | 100 | Plus |
Sfp60F-RA | 399 | CG42478-RA | 58..249 | 17..208 | 960 | 100 | Plus |
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 14:50:40
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
2R | 25286936 | 2R | 25172395..25172571 | 208..32 | 885 | 100 | Minus |
Blast to na_te.dros performed on 2014-11-28 14:50:41 has no hits.
BS33082.complete Sim4 Records
Sim4 to dmel-all-transcript-r5.52.fasta performed 2014-01-22 13:06:33 Download gff for
BS33082.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Sfp60F-RA | 58..248 | 17..207 | 100 | | Plus |
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 15:24:33 Download gff for
BS33082.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
Sfp60F-RA | 58..248 | 17..207 | 100 | | Plus |
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 15:24:33 Download gff for
BS33082.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
2R | 25172396..25172571 | 32..207 | 100 | <- | Minus |
Sim4 to na_arms.dmel.RELEASE5 performed 2014-01-22 13:06:33 Download gff for
BS33082.complete
Subject | Subject Range | Query Range | Percent | Splice | Strand |
arm_2R | 21059919..21060094 | 32..207 | 100 | <- | Minus |
BS33082.pep Sequence
Translation from 16 to 207
> BS33082.pep
MSRLFILALILSILADSAFGNIDELLRSIDRALGGALGINPSLARSGFGI
RTPSSEFSIGYGG*
BS33082.pep Blast Records
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-29 09:53:58
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
Sfp60F-PB | 63 | CG42478-PB | 1..63 | 1..63 | 306 | 100 | Plus |
Sfp60F-PA | 82 | CG42478-PA | 20..82 | 1..63 | 306 | 100 | Plus |