BDGP Sequence Production Resources |
Search the DGRC for FI14138
Library: | FI |
Tissue Source: | various Drosophila melanogaster |
Created by: | |
Date Registered: | 2005-11-08 |
Comments: | Drosophila melanogaster corrected cDNA clones |
Original Plate Number: | 141 |
Well: | 38 |
Vector: | pOT2 |
Associated Gene/Transcript | CG8087-RA |
Protein status: | FI14138.pep: gold |
Sequenced Size: | 478 |
478 bp assembled on 2010-03-25
GenBank Submission: BT122127.1
> FI14138.complete ATGAAGGCCACTACTATTCTAGCCGTTGTTTCCGTGCTCACCGCTTGTCT TTTGAGGAGCAGCGAGGCGGTGACCTGCACCGCCGATGCCACTGTCACAG GATGCATTGACTGCACCACCAATCCAACCGATTCCGAGTGCGTGGCCGAG GCAGCCGCCGATACAACCAGTACAACTGTAGCAACGCCCACCACCACCGC CACCACAACATCAGCGACGGCGACCACCACTGCGGCCTCCAGCACAAACA CTTCCTCCGGACGGCGAAAGATCGTGCGCATCACCAATCTGCGCTACACC AACGTTCGGCGCATCCGCGTCAACCGGAATGGATCGGGGAGCACCACCGT CCGGAATCGGAGGCGCAGGAACAACTCCAGACGTGTCAACGTGAGGCGGG CCAATGGAAACGTTATTGTTGTCGGCTAAGTACGCGGAATTCAATAAAAT GCTCAACAAGAAAAAAAAAAAAAAAAAA
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
chr3R | 27901430 | chr3R | 10389079..10389538 | 460..1 | 2300 | 100 | Minus |
chr3R | 27901430 | chr3R | 10387169..10387293 | 52..176 | 445 | 90.4 | Plus |
chr3R | 27901430 | chr3R | 10385782..10385892 | 42..152 | 360 | 88.3 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
3R | 32079331 | 3R | 14564322..14564782 | 461..1 | 2305 | 100 | Minus |
3R | 32079331 | 3R | 14562413..14562537 | 52..176 | 445 | 90.4 | Plus |
3R | 32079331 | 3R | 14561026..14561136 | 42..152 | 360 | 88.3 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
3R | 31820162 | 3R | 14305153..14305613 | 461..1 | 2305 | 100 | Minus |
3R | 31820162 | 3R | 14303244..14303368 | 52..176 | 445 | 90.4 | Plus |
3R | 31820162 | 3R | 14301857..14301967 | 42..152 | 360 | 88.2 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dvir\TART | 8500 | Dvir\TART TARTVIR 8500bp | 2388..2503 | 152..261 | 108 | 56.9 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
chr3R | 10389079..10389538 | 1..460 | 100 | Minus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
CG8087-RA | 1..429 | 1..429 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
CG8087-RA | 1..429 | 1..429 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
CG8087-RA | 1..429 | 1..429 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
CG8087-RA | 1..429 | 1..429 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
CG8087-RA | 1..460 | 1..460 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
CG8087-RA | 1..460 | 1..460 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
CG8087-RA | 24..483 | 1..460 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
CG8087-RA | 24..483 | 1..460 | 100 | Plus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
3R | 14564323..14564782 | 1..460 | 100 | Minus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
3R | 14564323..14564782 | 1..460 | 100 | Minus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
3R | 14564323..14564782 | 1..460 | 100 | Minus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
arm_3R | 10390045..10390504 | 1..460 | 100 | Minus |
Subject | Subject Range | Query Range | Percent | Splice | Strand |
---|---|---|---|---|---|
3R | 14305154..14305613 | 1..460 | 100 | Minus |
Translation from 0 to 428
> FI14138.pep MKATTILAVVSVLTACLLRSSEAVTCTADATVTGCIDCTTNPTDSECVAE AAADTTSTTVATPTTTATTTSATATTTAASSTNTSSGRRKIVRITNLRYT NVRRIRVNRNGSGSTTVRNRRRRNNSRRVNVRRANGNVIVVG*
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dana\GF17476-PA | 138 | GF17476-PA | 1..102 | 1..105 | 217 | 55.2 | Plus |
Dana\GF17512-PA | 162 | GF17512-PA | 1..50 | 1..50 | 144 | 64 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dere\GG21240-PA | 148 | GG21240-PA | 1..148 | 1..142 | 391 | 76.4 | Plus |
Dere\GG16860-PA | 192 | GG16860-PA | 1..122 | 1..108 | 257 | 52.5 | Plus |
Dere\GG16859-PA | 98 | GG16859-PA | 1..48 | 1..47 | 188 | 81.2 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
CG8087-PA | 142 | CG8087-PA | 1..142 | 1..142 | 701 | 100 | Plus |
CG14851-PA | 152 | CG14851-PA | 1..150 | 1..141 | 404 | 60.1 | Plus |
CG14850-PA | 158 | CG14850-PA | 1..134 | 1..133 | 267 | 49.3 | Plus |
CG14237-PB | 121 | CG14237-PB | 29..112 | 54..135 | 194 | 51.2 | Plus |
CG34273-PA | 128 | CG34273-PA | 21..104 | 51..133 | 161 | 41.7 | Plus |
CG13135-PC | 132 | CG13135-PC | 25..131 | 23..126 | 158 | 36.6 | Plus |
CG13135-PA | 132 | CG13135-PA | 25..131 | 23..126 | 158 | 36.6 | Plus |
CG14453-PA | 133 | CG14453-PA | 4..129 | 6..133 | 142 | 29.7 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dper\GL23371-PA | 155 | GL23371-PA | 1..116 | 1..111 | 308 | 68.1 | Plus |
Dper\GL23370-PA | 151 | GL23370-PA | 7..70 | 6..69 | 208 | 70.3 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dpse\GA20814-PA | 155 | GA20814-PA | 1..116 | 1..111 | 234 | 59.3 | Plus |
Dpse\GA13293-PA | 151 | GA13293-PA | 7..70 | 6..69 | 213 | 73.4 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dsec\GM25844-PA | 130 | GM25844-PA | 1..130 | 1..142 | 264 | 81 | Plus |
Dsec\GM24169-PA | 153 | GM24169-PA | 1..106 | 1..108 | 240 | 63 | Plus |
Dsec\GM24168-PA | 156 | GM24168-PA | 1..87 | 1..86 | 189 | 58.6 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dsim\GD15101-PA | 140 | GD15101-PA | 1..121 | 1..122 | 354 | 77.9 | Plus |
Dsim\GD15102-PA | 141 | GD15102-PA | 1..141 | 1..142 | 299 | 82.4 | Plus |
Dsim\GD15157-PA | 155 | GD15157-PA | 1..106 | 1..108 | 241 | 64.8 | Plus |
Dsim\GD15156-PA | 192 | GD15156-PA | 33..90 | 1..57 | 206 | 77.6 | Plus |
Dsim\GD15103-PA | 100 | GD15103-PA | 4..54 | 3..53 | 142 | 56.9 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dvir\GJ24218-PA | 170 | GJ24218-PA | 1..137 | 1..138 | 165 | 42.9 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dwil\GK18396-PA | 147 | GK18396-PA | 1..61 | 1..57 | 138 | 55.7 | Plus |
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
Dyak\GE26443-PA | 143 | GE26443-PA | 1..143 | 1..142 | 343 | 76.2 | Plus |
Dyak\GE24241-PA | 150 | GE24241-PA | 1..105 | 1..108 | 233 | 63.9 | Plus |
Dyak\GE24240-PA | 151 | GE24240-PA | 7..83 | 6..82 | 203 | 63.6 | Plus |
Translation from 1 to 428
> FI14138.hyp MKATTILAVVSVLTACLLRSSEAVTCTADATVTGCIDCTTNPTDSECVAE AAADTTSTTVATPTTTATTTSATATTTAASSTNTSSGRRKIVRITNLRYT NVRRIRVNRNGSGSTTVRNRRRRNNSRRVNVRRANGNVIVVG*
Subject | Length | Description | Subject Range | Query Range | Score | Percent | Strand |
---|---|---|---|---|---|---|---|
CG8087-PA | 142 | CG8087-PA | 1..142 | 1..142 | 701 | 100 | Plus |
CG14851-PA | 152 | CG14851-PA | 1..150 | 1..141 | 404 | 60.1 | Plus |
CG14850-PA | 158 | CG14850-PA | 1..134 | 1..133 | 267 | 49.3 | Plus |
CG14237-PB | 121 | CG14237-PB | 29..112 | 54..135 | 194 | 51.2 | Plus |
CG34273-PA | 128 | CG34273-PA | 21..104 | 51..133 | 161 | 41.7 | Plus |