Clone FI14138 Report

Search the DGRC for FI14138

Clone and Library Details

Library:FI
Tissue Source:various Drosophila melanogaster
Created by: 
Date Registered:2005-11-08
Comments:Drosophila melanogaster corrected cDNA clones
Original Plate Number:141
Well:38
Vector:pOT2
Associated Gene/TranscriptCG8087-RA
Protein status:FI14138.pep: gold
Sequenced Size:478

Clone Sequence Records

FI14138.complete Sequence

478 bp assembled on 2010-03-25

GenBank Submission: BT122127.1

> FI14138.complete
ATGAAGGCCACTACTATTCTAGCCGTTGTTTCCGTGCTCACCGCTTGTCT
TTTGAGGAGCAGCGAGGCGGTGACCTGCACCGCCGATGCCACTGTCACAG
GATGCATTGACTGCACCACCAATCCAACCGATTCCGAGTGCGTGGCCGAG
GCAGCCGCCGATACAACCAGTACAACTGTAGCAACGCCCACCACCACCGC
CACCACAACATCAGCGACGGCGACCACCACTGCGGCCTCCAGCACAAACA
CTTCCTCCGGACGGCGAAAGATCGTGCGCATCACCAATCTGCGCTACACC
AACGTTCGGCGCATCCGCGTCAACCGGAATGGATCGGGGAGCACCACCGT
CCGGAATCGGAGGCGCAGGAACAACTCCAGACGTGTCAACGTGAGGCGGG
CCAATGGAAACGTTATTGTTGTCGGCTAAGTACGCGGAATTCAATAAAAT
GCTCAACAAGAAAAAAAAAAAAAAAAAA

FI14138.complete Blast Records

Blast to MB8.fasta performed 2010-07-15 21:37:44
Subject Length Description Subject Range Query Range Score Percent Strand
CG8087-RA 461 CG8087-RA 1..461 1..461 2305 100 Plus
CG14851-RA 459 CG14851-RA 52..176 52..176 445 90.4 Plus
CG14850-RA 540 CG14850-RA 45..155 42..152 360 88.2 Plus
Blast to d_melanogaster_OreR.fa performed 2019-03-16 05:19:42
Subject Length Description Subject Range Query Range Score Percent Strand
chr3R 27901430 chr3R 10389079..10389538 460..1 2300 100 Minus
chr3R 27901430 chr3R 10387169..10387293 52..176 445 90.4 Plus
chr3R 27901430 chr3R 10385782..10385892 42..152 360 88.3 Plus
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 16:24:45 has no hits.
Blast to na_all.dmel.RELEASE6 performed 2019-03-16 05:19:41
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 14564322..14564782 461..1 2305 100 Minus
3R 32079331 3R 14562413..14562537 52..176 445 90.4 Plus
3R 32079331 3R 14561026..14561136 42..152 360 88.3 Plus
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 22:54:16
Subject Length Description Subject Range Query Range Score Percent Strand
3R 31820162 3R 14305153..14305613 461..1 2305 100 Minus
3R 31820162 3R 14303244..14303368 52..176 445 90.4 Plus
3R 31820162 3R 14301857..14301967 42..152 360 88.2 Plus
Blast to na_te.dros performed 2019-03-16 05:19:41
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2388..2503 152..261 108 56.9 Plus

FI14138.complete Sim4 Records

Sim4 to d_melanogaster_OreR.fa performed 2019-03-16 05:20:47 Download gff for FI14138.complete
Subject Subject Range Query Range Percent Splice Strand
chr3R 10389079..10389538 1..460 100   Minus
Sim4 to dmel-all-CDS-r5.12.fasta performed 2010-03-25 09:47:31 Download gff for FI14138.complete
Subject Subject Range Query Range Percent Splice Strand
CG8087-RA 1..429 1..429 100   Plus
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 21:57:42 Download gff for FI14138.complete
Subject Subject Range Query Range Percent Splice Strand
CG8087-RA 1..429 1..429 100   Plus
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 07:17:55 Download gff for FI14138.complete
Subject Subject Range Query Range Percent Splice Strand
CG8087-RA 1..429 1..429 100   Plus
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-27 06:03:01 Download gff for FI14138.complete
Subject Subject Range Query Range Percent Splice Strand
CG8087-RA 1..429 1..429 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-03-25 09:47:29 Download gff for FI14138.complete
Subject Subject Range Query Range Percent Splice Strand
CG8087-RA 1..460 1..460 100   Plus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 21:57:42 Download gff for FI14138.complete
Subject Subject Range Query Range Percent Splice Strand
CG8087-RA 1..460 1..460 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 07:17:55 Download gff for FI14138.complete
Subject Subject Range Query Range Percent Splice Strand
CG8087-RA 24..483 1..460 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 06:03:01 Download gff for FI14138.complete
Subject Subject Range Query Range Percent Splice Strand
CG8087-RA 24..483 1..460 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 05:20:47 Download gff for FI14138.complete
Subject Subject Range Query Range Percent Splice Strand
3R 14564323..14564782 1..460 100   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 05:20:47 Download gff for FI14138.complete
Subject Subject Range Query Range Percent Splice Strand
3R 14564323..14564782 1..460 100   Minus
Sim4 to na_all.dmel.RELEASE6 performed 2019-03-16 05:20:47 Download gff for FI14138.complete
Subject Subject Range Query Range Percent Splice Strand
3R 14564323..14564782 1..460 100   Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 07:17:55 Download gff for FI14138.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3R 10390045..10390504 1..460 100   Minus
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 19:34:30 Download gff for FI14138.complete
Subject Subject Range Query Range Percent Splice Strand
3R 14305154..14305613 1..460 100   Minus

FI14138.pep Sequence

Translation from 0 to 428

> FI14138.pep
MKATTILAVVSVLTACLLRSSEAVTCTADATVTGCIDCTTNPTDSECVAE
AAADTTSTTVATPTTTATTTSATATTTAASSTNTSSGRRKIVRITNLRYT
NVRRIRVNRNGSGSTTVRNRRRRNNSRRVNVRRANGNVIVVG*

FI14138.pep Blast Records

Blast to dana-all-translation-r1.3.fasta performed 2019-03-16 21:28:05
Subject Length Description Subject Range Query Range Score Percent Strand
Dana\GF17476-PA 138 GF17476-PA 1..102 1..105 217 55.2 Plus
Dana\GF17512-PA 162 GF17512-PA 1..50 1..50 144 64 Plus
Blast to dere-all-translation-r1.3.fasta performed 2019-03-16 21:28:06
Subject Length Description Subject Range Query Range Score Percent Strand
Dere\GG21240-PA 148 GG21240-PA 1..148 1..142 391 76.4 Plus
Dere\GG16860-PA 192 GG16860-PA 1..122 1..108 257 52.5 Plus
Dere\GG16859-PA 98 GG16859-PA 1..48 1..47 188 81.2 Plus
Blast to dmel-all-translation-r6.23.fasta performed 2019-03-25 10:29:41
Subject Length Description Subject Range Query Range Score Percent Strand
CG8087-PA 142 CG8087-PA 1..142 1..142 701 100 Plus
CG14851-PA 152 CG14851-PA 1..150 1..141 404 60.1 Plus
CG14850-PA 158 CG14850-PA 1..134 1..133 267 49.3 Plus
CG14237-PB 121 CG14237-PB 29..112 54..135 194 51.2 Plus
CG34273-PA 128 CG34273-PA 21..104 51..133 161 41.7 Plus
CG13135-PC 132 CG13135-PC 25..131 23..126 158 36.6 Plus
CG13135-PA 132 CG13135-PA 25..131 23..126 158 36.6 Plus
CG14453-PA 133 CG14453-PA 4..129 6..133 142 29.7 Plus
Blast to dper-all-translation-r1.3.fasta performed 2019-03-16 21:28:08
Subject Length Description Subject Range Query Range Score Percent Strand
Dper\GL23371-PA 155 GL23371-PA 1..116 1..111 308 68.1 Plus
Dper\GL23370-PA 151 GL23370-PA 7..70 6..69 208 70.3 Plus
Blast to dpse-all-translation-r3.2.fasta performed 2019-03-16 21:28:09
Subject Length Description Subject Range Query Range Score Percent Strand
Dpse\GA20814-PA 155 GA20814-PA 1..116 1..111 234 59.3 Plus
Dpse\GA13293-PA 151 GA13293-PA 7..70 6..69 213 73.4 Plus
Blast to dsec-all-translation-r1.3.fasta performed 2019-03-16 21:28:09
Subject Length Description Subject Range Query Range Score Percent Strand
Dsec\GM25844-PA 130 GM25844-PA 1..130 1..142 264 81 Plus
Dsec\GM24169-PA 153 GM24169-PA 1..106 1..108 240 63 Plus
Dsec\GM24168-PA 156 GM24168-PA 1..87 1..86 189 58.6 Plus
Blast to dsim-all-translation-r1.4.fasta performed 2019-03-16 21:28:10
Subject Length Description Subject Range Query Range Score Percent Strand
Dsim\GD15101-PA 140 GD15101-PA 1..121 1..122 354 77.9 Plus
Dsim\GD15102-PA 141 GD15102-PA 1..141 1..142 299 82.4 Plus
Dsim\GD15157-PA 155 GD15157-PA 1..106 1..108 241 64.8 Plus
Dsim\GD15156-PA 192 GD15156-PA 33..90 1..57 206 77.6 Plus
Dsim\GD15103-PA 100 GD15103-PA 4..54 3..53 142 56.9 Plus
Blast to dvir-all-translation-r1.2.fasta performed 2019-03-16 21:28:11
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\GJ24218-PA 170 GJ24218-PA 1..137 1..138 165 42.9 Plus
Blast to dwil-all-translation-r1.3.fasta performed 2019-03-16 21:28:12
Subject Length Description Subject Range Query Range Score Percent Strand
Dwil\GK18396-PA 147 GK18396-PA 1..61 1..57 138 55.7 Plus
Blast to dyak-all-translation-r1.3.fasta performed 2019-03-16 21:28:12
Subject Length Description Subject Range Query Range Score Percent Strand
Dyak\GE26443-PA 143 GE26443-PA 1..143 1..142 343 76.2 Plus
Dyak\GE24241-PA 150 GE24241-PA 1..105 1..108 233 63.9 Plus
Dyak\GE24240-PA 151 GE24240-PA 7..83 6..82 203 63.6 Plus

FI14138.hyp Sequence

Translation from 1 to 428

> FI14138.hyp
MKATTILAVVSVLTACLLRSSEAVTCTADATVTGCIDCTTNPTDSECVAE
AAADTTSTTVATPTTTATTTSATATTTAASSTNTSSGRRKIVRITNLRYT
NVRRIRVNRNGSGSTTVRNRRRRNNSRRVNVRRANGNVIVVG*

FI14138.hyp Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 16:10:59
Subject Length Description Subject Range Query Range Score Percent Strand
CG8087-PA 142 CG8087-PA 1..142 1..142 701 100 Plus
CG14851-PA 152 CG14851-PA 1..150 1..141 404 60.1 Plus
CG14850-PA 158 CG14850-PA 1..134 1..133 267 49.3 Plus
CG14237-PB 121 CG14237-PB 29..112 54..135 194 51.2 Plus
CG34273-PA 128 CG34273-PA 21..104 51..133 161 41.7 Plus