Clone FMO01285 Report

Search the DGRC for FMO01285

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:12
Well:85
Vector:pMK33-CFH-BD
Associated Gene/Transcriptctp-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01285.5prime Sequence

308 bp (308 high quality bases) assembled on 2008-03-12

> FMO01285.5prime
AAAAAACAAAGTTATCAGTCGACATGTCTGATCGCAAGGCCGTGATTAAA
AATGCCGACATGAGCGAGGAGATGCAGCAGGATGCCGTCGATTGTGCGAC
ACAGGCCCTCGAGAAGTACAACATTGAAAAGGACATTGCGGCCTACATCA
AGAAGGAGTTCGACAAAAAATACAATCCCACATGGCATTGCATTGTCGGT
CGCAACTTTGGATCGTATGTCACACACGAGACGCGCCACTTTATTTACTT
CTATTTGGGCCAGGTGGCTATTTTACTGTTTAAGAGCGGTGCAAGCTTTC
TAGACCAT

FMO01285.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:19:17
Subject Length Description Subject Range Query Range Score Percent Strand
ctp-RE 4061 CG6998-RE 216..482 24..290 1335 100 Plus
ctp-RC 4416 CG6998-RC 571..837 24..290 1335 100 Plus
ctp-RA 1483 CG6998-RA 216..482 24..290 1335 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 20:19:16
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 4698295..4698455 130..290 805 100 Plus
2L 23513712 2L 1344616..1344882 24..290 720 84.6 Plus
X 23542271 X 4691737..4691845 24..132 545 100 Plus
Blast to na_te.dros performed on 2014-11-28 20:19:16 has no hits.

FMO01285.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:45:45 Download gff for FMO01285.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6998-RC 501..780 16..295 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 23:47:11 Download gff for FMO01285.5prime
Subject Subject Range Query Range Percent Splice Strand
ctp-RA 208..487 16..295 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 21:02:03 Download gff for FMO01285.5prime
Subject Subject Range Query Range Percent Splice Strand
ctp-RA 208..487 16..295 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 21:02:03 Download gff for FMO01285.5prime
Subject Subject Range Query Range Percent Splice Strand
X 4691730..4691844 17..131 97 -> Plus
X 4698297..4698460 132..295 98   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 23:47:11 Download gff for FMO01285.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 4585763..4585877 17..131 97 -> Plus
arm_X 4592330..4592493 132..295 98   Plus