Clone FMO01324 Report

Search the DGRC for FMO01324

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:13
Well:24
Vector:pMK33-CFH-BD
Associated Gene/TranscriptGATAe-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO01324.5prime Sequence

855 bp (440 high quality bases) assembled on 2008-03-18

> FMO01324.5prime
AATAGAAAAAAAAAAAGTTATCAGTCGACATGGTCTGCAAAACTATCTCA
CCGGGTGTAAACATGCAGCTGAAGATGGAACAGCAGACAACGCAGCAGCA
GCAGCAACAACAGCAACAGCAACAGCAACAGCAACAATTGCAACAGCAAC
AGCATCAGGCTCTAACCAAGCAGCAGCTTCAACTGCTGGACAAAATCAAA
CTCGAGTCCAGCAACGGCGCCGATCAGTTGGCCCAGCAGACGGCCAACAA
TCTGGATGAGCAGCAGGAGCAGCAGCAACAACACCAACAGCAAGCCGCAA
CATCGGTGGGCGTGGTGGTGCAGACGGGCCAAGCGGGCGTCAGCGAACCG
GAGGAGCAGTACGTGGTGGTGCCACGCAACCTGCGCCGTATTCTCACCAC
AGCCGGCACACTTGAATTAAACGAAGCTCGTGAAGGAGAACTGATCACTA
ACGCCAGCAACGCGAGCTCAGGATCTGCTTCGGATAGCCACATCGAGTAC
CAGCGCAGTGCACACCATTCTCCCGGAGCCACTCACTACGTGCAGATGGC
GCCACGCAACGCAGAGGTGACGGAACAGGTGGGAGCTGCTGCCGGAGCTC
CGCCGGGGCACCATCTTCGCCTATCCTATTATCTGCAACGGTGACGATGT
GGCCGCGAATCAAAATCGAAACACTCGAGAAGGGAGAGGCGACGGGGGGA
GTCGAACAACGGCAGCAGCAACTGCAGCAACATCAGCATCAGCAACACGG
CAATGGTCCCACACCCAACGGAACTAGCTACGGCGAGACCATATTGATCA
CAGCGAGGGCGGAGGCACTGCACTTCCCACCAAAAGCAGTAGCAGCATCC
AGCAC

FMO01324.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-28 19:35:38
Subject Length Description Subject Range Query Range Score Percent Strand
GATAe-RA 3086 CG10278-RA 466..1289 30..854 3635 96.7 Plus
GATAe-RC 2879 CG10278-RC 301..1082 72..854 3440 96.7 Plus
GATAe-RB 2983 CG10278-RB 408..1186 75..854 3425 96.7 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-28 19:35:32
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 16016226..16016565 73..412 1670 99.4 Plus
3R 32079331 3R 16016709..16017116 413..822 1525 93.7 Plus
3R 32079331 3R 16012739..16012787 30..78 215 95.9 Plus
Blast to na_te.dros performed 2014-11-28 19:35:35
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6720..6916 97..293 362 68.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6714..6943 73..306 356 66.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2325..2539 66..302 348 68.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2306..2496 101..304 277 64.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2444..2665 80..302 274 65.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2618..2832 77..304 239 62.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6940..7209 34..304 218 60.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6750..6891 705..854 181 65.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2341..2383 705..747 179 90.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6729..6879 705..854 175 61.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2311..2442 169..301 174 65.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6735..6866 169..307 165 65 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6498..6757 60..306 161 57.7 Plus
roo 9092 roo DM_ROO 9092bp 1038..1151 189..304 160 64.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6771..6820 705..753 157 82 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2347..2391 259..304 155 84.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6720..6778 247..306 153 75 Plus
roo 9092 roo DM_ROO 9092bp 1059..1111 259..309 152 79.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6721..6791 233..304 150 73 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6792..6841 705..753 148 80 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6721..6818 208..304 144 67.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6843..6927 705..788 144 66.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2292..2418 176..304 143 62.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6804..6846 705..747 143 81.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2350..2435 705..795 137 64.8 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2301..2364 239..304 135 71.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6825..6868 705..748 130 77.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1528..1574 259..306 129 77.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2404..2549 705..854 128 57.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2307..2430 180..304 127 62.3 Plus
roo 9092 roo DM_ROO 9092bp 1076..1161 209..292 127 67 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2425..2467 705..747 125 76.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2497..2539 705..747 125 76.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6740..6835 209..306 124 66.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2632..2772 705..849 121 57.8 Plus
gypsy11 4428 gypsy11 GYPSY11 4428bp 963..1011 240..288 119 71.4 Plus
Dvir\Het-A 6610 Dvir\Het-A HETAVIR 6610bp 3291..3356 707..770 118 68.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1552..1587 705..740 117 80.6 Plus
roo 9092 roo DM_ROO 9092bp 1131..1184 705..758 117 68.5 Plus
Dyak\TART 8444 Dyak\TART TARTYAK 8444bp 6594..6629 707..742 117 80.6 Plus
TART-C 11124 TART-C TARTC 11124bp 8050..8085 707..742 117 80.6 Plus
Dyak\TART 8444 Dyak\TART TARTYAK 8444bp 7955..7986 261..292 115 84.4 Plus
TART-C 11124 TART-C TARTC 11124bp 9399..9430 261..292 115 84.4 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6759..6793 259..293 112 80 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1552..1591 256..295 110 75 Plus
BS 5142 BS BS 5142bp 2032..2074 251..290 109 76.7 Plus

FMO01324.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.5.fasta performed 2008-05-23 17:46:30 Download gff for FMO01324.5prime
Subject Subject Range Query Range Percent Splice Strand
CG10278-RA 469..1286 30..847 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 22:43:03 Download gff for FMO01324.5prime
Subject Subject Range Query Range Percent Splice Strand
GATAe-RA 466..1283 30..847 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-28 20:23:33 Download gff for FMO01324.5prime
Subject Subject Range Query Range Percent Splice Strand
GATAe-RA 466..1283 30..847 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-28 20:23:33 Download gff for FMO01324.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 16012739..16012783 30..74 97 -> Plus
3R 16016228..16016565 75..412 99 -> Plus
3R 16016709..16017143 413..847 94   Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 22:43:03 Download gff for FMO01324.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 11838461..11838505 30..74 97 -> Plus
arm_3R 11841950..11842287 75..412 99 -> Plus
arm_3R 11842431..11842865 413..847 94   Plus